E xpression pattern and putative func tion of E R -stress molec ules in tooth formation 1 1 1 1 Yam Prasad Aryal , Tae-Young K im , E ui-S eon Lee , E lina Pokharel , S hijin S ung , J ae-K wang J ung , Hitoshi Yamamoto , 2 1 1 C hang-Hyeon An , Wern-J oo S ohn , J ae-Young K im 1# 3 1 2 1 School of Dentistry, IHBR, Kyungpook National University, Daegu , Korea, Department of Histology and Developmental Biology, Tokyo Dental 3 College, Tokyo, Japan, Division of Biotechnology and Convergence, Daegu Haany University, Gyeongsan Korea BACKGROUND AIM Endoplasmic reticulum (ER) is the site for
protein folding and modification, but with the accumulation of Although few studies described the role of ER- unfolded and misfolded proteins in the ER lumen, there is stress molecules, however, they could not address creation of unfolded protein response (UPR) which in turn whether all ER-stress molecules involved during tooth activates ER-stress signaling molecules (Ire1, Atf6 and Perk) development or not. Here, the roles of ER-stress to maintain homeostasis. ER-stress pathway and its relation molecules: Atf6, Ire1, Perk and Xbp1 were elucidated in has been described in development of
various tissues and the cap, bell and secretory stages of tooth morphogenesis disease model system. Tooth, a type of hard tissue, also through gene expression analysis. involves ER-stress pathway especially during ameloblast and odontoblast differentiation (Brookes et al., 2017; Kim et al., 2014) however, data on the involvement of major ER-stress sensors in tooth development are lacking. METHODS Animal: Mouse embryos were obtained from time-mated pregnant mice that were maintained in an optimal environment. The day that the vaginal plug was confirmed was designated as embryonic day 0 (E0).
Embryos at E14, E16 and postnatal (PN) day 0 were used as representatives of the cap, bell, and secretory stages of tooth development, respectively. Quantitative PCR (qPCR) and In situ hybridization: RNA was extracted from the molar tooth germ of E14, E16 and postnatal day 0 mice, and cDNA was synthesized for qPCR analysis and section in situ hybridization were performed at 68 °C using digoxigenin (DIG)-labeled RNA probes and standard protocols, as described previously (Aryal et al., 2019). Histology and Immunohistochemistry: Hematoxylin and eosin (H&E) staining and immunohistochemistry were
performed as previously described (Aryal et al., 2019). Primary antibodies were directed against Ire1, Atf6, Xbp1 and GRP78. RESULTS Figure 1. Expression of ER-stress related signaling molecules in different stages of molar development Figure 3. Expression patterns of ER-stress related signaling molecules during bell (left) and secretory stage (right) of tooth development. H&E, Hematoxylin and Eosin staining; IEE, inner enamel epithelium; OEE, outer enamel epithelium; DP, dental papilla; Od, odontoblasts; Ab, ameloblasts; SR, stellate reticulum. Scale bars: 50 μm (a–i). Figure 2. Expression of
ER-stress related signaling molecules during cap stage of tooth development. H&E, Hematoxylin and Eosin staining; EK, enamel knot; DP, dental papilla. Figure 4. Localization patterns of ER-stress related molecules during secretory stage Scale bars: 50 μm (a–i). of mice molar development. Scale bars: 200 μm (a–f); 50 μm (a’a”-f’f”). CONCLUSION REFERENCES ACKNOWLEDGEMENTS This study was supported by the National Research • ER-stress signaling molecules are expressed at • Adams et al., 2019; Foundation of Korea (grant NRF-2018R1A2A3075600) various stages of tooth development: cap, bell
https://doi.org/10.3389/fmolb.2019.00011 funded by the Ministry of Education, Science and and secretory stages • Aryal et al., 2019; Technology, Republic of Korea. • Distinct localization patterns of ER-stress https://doi.org/10.1002/jcp.28635 sensors along secretory odontoblasts and • Brookes et al., 2017; Contact information ameloblasts suggested their involvement in the https://doi.org/10.3389/fphys.2017.00653 modulation of protein overload especially • Kaneko et al., 2017; during extracellular matrix secretion https://doi.org/10.1248/bpb.b17-00342 Jae-Young Kim, Department of Biochemistry,
School • Precise functional evaluations of these ER- • Kim et al., 2014; of Dentistry, IHBR, Kyungpook National University, stress related signaling molecules is necessary https://doi.org/10.1177/0022034514525199 2177 Dalgubeol-daero, Joong-gu, Daegu 41940, Korea to understand and regenerate the dental hard • Uchibe et al., 2012 Tel: +82-53-420-4998; Fax: +82-53-421-4276 tissue with proper https://doi.org/10.1002/dvdy.23808 E-mail: jykim91@knu.ac.kr [K. Development and regeneration-1] Expression pattern and developmental function of Piezo1 in tooth and salivary glands during embryogenesis
Eui-Seon Lee¹, Yam Prasad Aryal¹, Tae-Young Kim¹, Elina Pokharel¹, Shijin Sung¹, Ji-Youn Kim², Wern-Joo Sohn³, Sung-Jin Cho⁴, Jae-Kwang Jung¹, Jae-Young Kim¹˙* ¹School of Dentistry, Kyungpook National University, Daegu 41944, South Korea, ²Department of Dental Hygiene, Gachon University, Incheon 21936, South Korea, ³Pre-Major of Cosmetics and Pharmaceutics, Daegu Haany University, Gyeongsan 38610, South Korea, ⁴School of Biological Sciences, Chungbuk National University, Cheongju 28644, South Korea Recent researches showed the importance of mechanically-activated factors in condition of
organogenesis, especially in formation of hard tissue and secretory organs. Craniofacial regions are composed of harmonious patterned arrangement of hard and secretory tissues in restricted area. Piezo type mechanosensitive ion channel component 1 (Piezo1) is a sensor and transducer of mechanical stimuli which has critical roles in various mechano- transduction processes in touch, pain, proprioception, vascular development and blood pressure regulation. In this study, we examined the detail expression pattern of Piezo1 using in situ hybridization and RT-qPCR. To understand the precise
signaling regulations of Piezo1, we evaluated the related signaling network, we examined the altered expression patterns of signaling molecules after treatment of siRNA Piezo1 (siPiezo1) using RT-qPCR. Piezo1 downregulated SMG using siPiezo1 with in vitro organ cultivation was histologically observed with immunohistochemistry. Our result suggests that Piezo1 modulates mechanosensitive molecules related with nerve innervation, in hard tissue: pulp-dentin complex and in gland: acinar cells and duct forming regions. A B C 4 Fer1L4 Fer1L4 is not targeted by LP 200 bp 3 Relative Copy No. 2 ▼ ▼ ▼
Fer1L4 Fwd Fer1L4 Rev Fer1L4 1 1 2 3 9 DIC mCherry Merged Fer1L4 is targeted by LP 1 ▼ ▼ ▼ ▼ ▼ 3,300 bp Fer1L4 Fwd CMV Fer1L4 Rev 0 1 mCherry TK 1 2 3 9 Lox5171 LoxP Primer Sequence (5' to 3') Primer Sequence (5' to 3') Negative control mCherry positive #01 mCherry positive #02 mCherry positive #03 mCherry positive #04 mCherry positive #05 mCherry positive #06 mCherry positive #07 mCherry positive #08 mCherry positive #09 mCherry positive #10 mCherry positive #11 mCherry positive #12 Fer1L4 GCACTGCGCCATGGCTCT Fer1L4 GACGGGTTATAGAGCTGG Fwd Rev GAPDH GCACCACCAACTGCTTAG GAPDH AGTCTTCTGGGTGGCAGT
Fwd C Rev GA D E rd 1 590 bp 1 st 590 bp 2 nd 436 bp 3 348 bp st 2 nd 436 bp C 3 348 bp negative control #4 #6 #8 #9 #11 negative control #4 #6 #8 #9 #11 negative control #4 #6 #8 #9 #11 rd CMV 1 mCherry TK 1 2 3 9 600 Lox5171 LoxP 500 Primer Sequence (5' to 3') Primer Sequence (5' to 3') 300 st st 1 Fwd TCACGGGCTAGCAAGGAC 1 Rev GAGCCGTACATGAACTGA 2 nd Fwd TACCCGATCCCAGCTC 2 nd Rev CCCTCGATCTCGAACT rd rd 3 Fwd CGACGGTATGGGAAGA 3 Rev CGTGGCCGTTCACGGAGC F Genome 5’ Homologous arm 5’ Homologous arm Lox5171 A C Fer1L4 1 2 3 9 D Fer1L4 Fer1L4 1 2 3 9 Cleavage CMV 1 mCherry TK 1 2 3 9
AGACGCCTAACAGAGCTGCCAGGCA TCTGCGGATTGTCTCGACGGTCCGT Lox5171 LoxP 5’AGACGCCTAACAGAGCTGCCAGG Cas9 gRNA 3’ CRE CRE CMV mCherry TK SV40 Lox5171 LoxP 5′ HA 3′ HA eGFP Neo Lox5171 LoxP Landing pad (LP) homologous recombination CMV Targeting vector mCherry TK Lox5171 LoxP B 5’ homologous arm 3’ homologous arm SV40 RMCE Landing pad Fer1L4 SV40 eGFP Neo 1 eGFP Neo 1 2 3 9 Lox5171 LoxP Lox5171 LoxP Targeting vector (TV) CMV 1 mCherry TK 1 2 3 9 Lox5171 LoxP A B 332 bp C SV40 5 1 eGFP Neo 1 2 3 9 4 Lox5171 LoxP ** Primer Sequence (5' to 3') Primer Sequence (5' to 3') 3 Fwd AGACTGAGCCACAGCACTGC Rev
CGCAGCCCTCCATGGTGAAC Percentage of cells expressing GFP, but not mCherry (%) 2 Before RMCE After RMCE 0 DIC mCherry 1 Before RMCE After RMCE GFP Marged 500 D E 82 300 Percentage of cells expressing GFP, but not mCherry (%) 3 Percentage of cells expressing GFP, but not mCherry (%) 79 Save cost & time! 5’ Homologous arm Lox5171 GFP 5 4 ** 81 ** 80 6 Decrease 2 4 ** Minimum 12 months processing time 1 2 Save cost & time! 0 g CRE g CRE g CRE g CRE 0 Before RMCE Before sorting After sorting 0.5 1.0 2.0 4.0 2 .0 g Ta rg e tin g ve c to r After RMCE [K. Development and regeneration-2] Next
generation vector platform for easy replacement of GOI using RMCE-mediated site specific integration in CHO Cells Jaewon Kim¹, Joontae Park¹˙* ¹Division of Life Sciences, Incheon National University, Incheon KS006, Korea Chinese hamster ovary (CHO) cells are mammalian hosts commonly used in the production of biotherapeutic agents. Traditional CHO cell line development is based on random integration of transgenes into the genome, providing the unpredictable expression. Thus, improved approaches to establish clones that exhibit predictable levels of expression and desirable amounts have been
proposed as potentially effective strategies in the biopharmaceutical industry. In this study, we developed a recombinase mediated cassette exchange (RMCE) system using Cre/Lox. Cells with a landing pad (LP; containing mCherry flanked by Lox5171 and LoxP sequences), which serve as a prerequisite for RMCE, were established by incorporating LP into predefined hotspots using CRISPR / Cas9 mediated homologous recombination. RMCE exchanged LP with a targeting vector (containing GFP flanked by Lox5171 and LoxP) as evidenced by the appearance of cells expressing GFP but losing mCherry. Moreover,
optimal conditions for RMCE were established by adjusting the ratio between the targeting vector and the Cre plasmid to 4:1. Furthermore, FACS sorting enriches up to 80% GFP positive cells in which RMCE has been successfully generated, providing the possibility of RMCE being used for commercial cell line development time. A 3 0 0 B ** * ** 3 0 0 0 4 4 /p ) /p ) 4 s e G ll lin e s e ra 4 G D 2 0 0 in g le ce ll lin e ra c ife 2 0 0 0 b le ce ife c to S u L e la tive to D 1 0 0 0 ta u L tive 1 0 0 (R S la e (R 0 0 .3 μ g C trl + - - 0 6 .0 μ g B A C - + + 0 .3 μ g C trl + - - T o l2 tra n sp o
sa se - - + V e c to r 0 .6 6 7 μ g 6 .0 μ g B A C - + + Luciferase T o l2 tra n sp o sa se V e c to r 0 .6 6 7 μ g - - + Actin C 0 .8 0 .3 μ g C trl 6 .0 μ g B A C 0 .6 B A C & T o l2 ) lls e μ C 0 .4 5 (E 0 .2 0 .0 3 6 9 1 2 1 5 1 8 2 1 2 4 2 7 3 0 D a y s A B 3 0 0 1 0 0 *** * ) r 6 l e 0 ** ve e b m trl # *** e le trl) 2 0 0 BAC ll lin ce u n y C ll lin ce n tio C to (200kb ~ 300kb) le g p o c to e tiv 5 0 le g crip tive la Targeting in S e n e la e in S s n ra e (R 1 0 0 Vector G (R T *** 0 0 0 .3 μ g C trl + - - 0 .3 μ g C trl + - - 6 .0 μ g B A C - + + 6 .0 μ g B A C - + + T o l2 tra n
sp o sa se - - + T o l2 tra n sp o sa se - - + Tol2 V e c to r 0 .6 6 7 μ g V e c to r 0 .6 6 7 μ g CAM Targeting Vector A B C **** ** * **** 6 0 0 1 5 0 0 )) id ) .3 2 0 0 la sm trl(0 s e 4 0 0 trl(0 .3 )) s e ra ** * s e ra C c ife ra 1 0 0 0 ife to u e la tive to P c ife **** c L 2 0 0 u e la tiv e to C u L tiv e 1 0 0 (R L la e **** (R 5 0 0 (R 0 C o n tro l 0 .3 μ g + - - 0 C o n tro l (μ g ) - - - - - - B A C 6 .0 μ g - + + B A C (μ g ) 8 8 8 8 8 8 T o l2 tra n s p o s a s e V e c to r - + - 0 C o n tro l (μ g ) 0 .3 - - - - - - B A C : T o l2 tra n s p o s a s e - 9 :0 .5 9 :1 9 :3 9 :6
9 :9 T o l2 tra n s p o s a s e m R N A - - + m R N A ra tio B A C (μ g







