Page 5 - ebook
P. 5

Calsequestrin 1 Is an Active Partner








                                                                                                    of Stromal Interaction Molecule 2 in Skeletal Muscle










                                                                                                                                     Seung Yeon Jeong                                           1,2   , Mi Ri Oh                       1,2   , Jun Hee Choi                                 1,2   , Jin Seok Woo , and Eun Hui Lee                                                                           1,2,*
                                                                                                                                                                                                                                                                                                                                                  3




                                                                                                                                                                   1 Department of Physiology, College of Medicine, The Catholic University of Korea, Seoul 06591




                                                                                                                                                                   2 Department of Biomedicine & Health Sciences, Graduate School, The Catholic University of Korea, Seoul 06591



                                                                                                                                                                   3  Department of Physiology, David Geffen School of Medicine, UCLA, Los Angeles, CA 10833, USA



                                                                                                                                                                   *Correspondence: ehui@catholic.ac.kr








        ABSTRACT                                                                                                                                                                                      RESULTS








                                                                                                                           2+
             Calsequestrin 1 (CASQ1) in skeletal muscle buffers and senses Ca in the sarcoplasmic reticulum (SR).
             CASQ1 also regulates store-operated Ca                              2+  entry (SOCE) by binding to stromal interaction molecule 1                                                                                                                                                                      ◀ Figure 1. Coimmunoprecipitation of CASQ1 with STIM2 and                                                                                                                                           ◀ Figure 4. Abnormal mitochondria

             (STIM1). Abnormal SOCE and/or abnormal expression or mutations in CASQ1, STIM1, or STIM2 are                                                                                                                                                                                                           the binding assay of CASQ1 regions to STIM2: (A) Triad samples                                                                                                                                      in the shape and the expression level

             associated with human skeletal, cardiac, or smooth muscle diseases. However, the functional relevance of                                                                                                                                                                                               obtained     from      rabbit    skeletal    muscle      were     subjected     to    a                                                                                                             of Drp-1 or Mfn-1: (A) Mitochondria
                                                                                                                                                                                                                                                                                                                    coimmunoprecipitation assay with anti-CASQ1 antibody. ‘Triad sample’
             CASQ1 along with STIM2 has not been studied in any tissue, including skeletal muscle. First, in the                                                                                                                                                                                                    indicates a simple immunoblot of the triad sample. ‘Without anti-                                                                                                                                   in the myotubes were observed using
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TEM. Areas in the numbered boxes
             present study, it was found by biochemical approaches that CASQ1 bound to STIM2 via its 92 N-terminal                                                                                                                                                                                                  CASQ1 Ab’ indicates a reaction without anti-CASQ1 antibody. Three                                                                                                                                   (from 1 to 3) were enlarged. Swelling

             amino acids (C1 region). Next, to examine the functional relevance of the CASQ1-STIM2 interaction in                                                                                                                                                                                                   independent experiments were conducted, and a representative result is                                                                                                                              mitochondria were found in C1-
                                                                                                                                                                                                                                                                                                                    presented. The degree of coimmunoprecipitated STIM2 to total STIM2
             skeletal muscle, the full-length wild-type CASQ1 or the C1 region was expressed in mouse primary                                                                                                                                                                                                       is     presented       as      histograms.       STIM2         was       successfully                                                                                                               expressing myotubes. The bar
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        represents 2 μm. (B) The length of the
             skeletal myotubes, and the myotubes were examined using single-myotube Ca                                                      2+  imaging experiments and                                                                                                                                             coimmunoprecipitated with CASQ1. IB, IP, or Ab indicates immunoblot,                                                                                                                                swelling mitochondria was measured,

                                                                                                                                                                                                                                                                                                                                                                                *
             transmission electron microscopy observations. The CASQ1-STIM2 interaction via the C1 region                                                                                                                                                                                                           immunoprecipitation, or antibody, respectively. Significant difference                                                                                                                              and the results are summarized as
                                                                                                                                                                                                                                                                                                                    was compared with ‘without anti-CASQ1 Ab’ (p < 0.05). (B and E)
             decreased SOCE, increased intracellular Ca                                 2+    release for skeletal muscle contraction, and changed                                                                                                                                                                  Schematic diagrams of mouse CASQ1 regions are presented. Numbers                                                                                                                                    h i sto gr ams . T h e v alu es wer e
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        normalized to the mean values of the
             intracellular Ca          2+    distributions (high Ca               2+   in the SR and low Ca                    2+   in the cytosol were observed).                                                                                                                                                  indicate the sequence of amino acids. The S1B region is presented                                                                                                                                   vector control. The values are presented

             Furthermore, the C1 region itself (which lacks Ca                                   2+   - buffering ability but has STIM2-binding ability)                                                                                                                                                            according to a previous report [35]. (C, D and F) The bound proteins                                                                                                                                as the mean ± SEM for the number of
                                                                                                                                                                                                                                                                                                                    that were obtained from the binding assays of GST-CASQ1 or
             decreased the expression of Ca                        2+   -related proteins (canonical-type transient receptor potential cation                                                                                                                                                                       GSTCASQ1 regions with triad samples were subjected to immunoblot                                                                                                                                    mitochondria in Table 2. (C) The
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        myotube lysate was subjected to
             channel type 6 and calmodulin 1) and induced mitochondrial shape abnormalities. Therefore, in skeletal                                                                                                                                                                                                 assays with anti-GST (to detect GST-CASQ1 or GST-CASQ1 regions)                                                                                                                                     immunoblot assays with antibody

             muscle, CASQ1 plays active roles in Ca movement and distribution by interacting with STIM2 as well as                                                                                                                                                                                                  or anti-STIM2 antibody. GST was used as a negative control. Three                                                                                                                                   against Drp-1 or Mfn-1. α-actin was
                                                                              2+
                                                                                                                                                                                                                                                                                                                    independent experiments were conducted. The relative amount of
             Ca sensing and buffering                                                                                                                                                                                                                                                                               STIM2 to the corresponding amount of the CASQ1 region is presented                                                                                                                                  used as a loading control. Three
                  2+
                                                                                                                                                                                                                                                                                                                    as histograms on the right-hand side. The value for the relative amount                                                                                                                             independent experiments per protein
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        were conducted. The expression level
                                                                                                                                                                                                                                                                                                                    of STIM2 to GST was regarded as 1, and others were normalized by this                                                                                                                               of each protein normalized to the mean
                                                                                                                                                                                                                                                                                                                    value. Significant difference compared with GST (p < 0.05).                                                                                                                                         value of the vector control is presented
                                                                                                                                                                                                                                                                                                                            *
        I NTRODUCTI ON                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  as histograms (Table 2). Significant
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         *
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        difference compared with vector control
                                                                                                                                                                                                                                                                                                                                                 2+
                                                                                                                                                                                                                                                                                                                    ◀ Figure 1. SOCE, Ca amount in the SR, and cytosolic Ca                      2+  level                                                                                                              (p < 0.05). Significant difference
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         #
                                                                                                                                                                                                                                                                                                                    in WT CASQ1 or C1-expressing mouse skeletal myotubes: (A)                                                                                                                                           compared with WT CASQ1 (p < 0.05).
                                                                                                                                                                                                                                                                                                                    Mouse primary skeletal myotubes that were transfected with cDNA of
              Skeletal muscle contracts or relaxes to move the body or to sustain body postures, which is dependent on                                                                                                                                                                                              empty vector (vector control), full-length wild-type CASQ1 (WT

              the cytosolic Ca level of myotubes (i.e., skeletal muscle cells) [1-5].                                                                                                                                                                                                                               CASQ1), or C1 region (C1) were subjected to immunocytochemistry
                                        2+
                                                                                                                                                                                                                                                                                                                    using anti-GFP antibodies. The bar represents 100 µm. (B) The lysate
              A transient elevation of cytosolic Ca                        2+   levels couples action potentials on the t-tubule membrane with                                                                                                                                                                      of WT CASQ1 or C1-expressing myotubes was subjected to a

              skeletal muscle contractions (called excitation-contraction (EC) coupling). During skeletal EC coupling,                                                                                                                                                                                              coimmunoprecipitation assay with anti-CASQ1 antibody, and the
                                                                                                                                                                                                                                                                                                                    immunoprecipitate was subjected to immunoblot analysis with anti-
                                                                                                    2+
              dihydropyridine receptor (DHPR, a voltage-gated Ca channel on the t-tubule membrane) is activated by                                                                                                                                                                                                  CASQ1 or anti-STIM2 antibody. ‘Myotube lysate’ indicates a simple
              sensing action potentials in response to acetylcholine and changes its conformation. Active DHPR                                                                                                                                                                                                      immunoblot of the myotube lysate. ‘Without anti-CASQ1 Ab’ indicates

              activates ryanodine receptor type 1 (RyR1, an internal Ca                                      2+  channel on the sarcoplasmic reticulum (SR)                                                                                                                                                         a   reaction     without     anti-CASQ1        antibody.     Three     independent
                                                                                                                                                                                                                                                                                                                    experiments were conducted, and a representative result is presented.
              membrane) via physical interactions. Active RyR1 releases Ca from the SR (an internal Ca Ca store) to                                                                                                                                                                                                 The degree of coimmunoprecipitated STIM2 to total STIM2 is
                                                                                                                                                                        2+
                                                                                                                  2+
              the cytosol, and Ca turns on contractile proteins to evoke skeletal muscle contractions. In addition to the                                                                                                                                                                                           presented        as       histograms.         STIM2         was        successfully
                                             2+
              major role of the SR of storing internal Ca mitochondria also have a role storing internal Ca in skeletal                                                                                                                                                                                             coimmunoprecipitated with CASQ1. IB, IP, or Ab indicates
                                                                                   2+
                                                                                                                                                                     2+
                                                                                                                                                                                                                                                                                                                                                                            antibody,
                                                                                                                                                                                                                                                                                                                                       immunoprecipitation,
                                                                                                                                                                                                                                                                                                                                                                     or
                                                                                                                                                                                                                                                                                                                                                                                           respectively.
                                                                                                                                                                                                                                                                                                                    immunoblot,
              muscle [6,7]. To relax skeletal muscle, cytosolic Ca moves back to the SR via sarcoplasmic/endoplasmic                                                                                                                                                                                                * Significant difference was compared with ‘without anti-CASQ1 Ab’ (p
                                                                                                 2+
                                     2+
              reticulum Ca -ATPase1a (SERCA1a, a Ca                                       2+   pump in the SR membrane) [8]. The coordinated                                                                                                                                                                        < 0.05). (C) Myotube widths were measured. The normalized mean
              arrangement of the proteins mentioned above in the triad junction (which is composed of two t-tubule                                                                                                                                                                                                  values of each to the mean value of the vector control are summarized
                                                                                                                                                                                                                                                                                                                    as histograms. There was no significant difference in the width of the
              membranes and an SR between them, such as a sandwich) is required for the transient elevation or                                                                                                                                                                                                      myotubes. (D) The myotube lysate was subjected to immunoblot assays
                                                    2+
              removal of cytosolic Ca during the contraction or relaxation of skeletal muscle [9-11].                                                                                                                                                                                                               with antibody against MyoD or myogenin. α-actin was used as a
                                                                                                                                                                                                                                                                                                                    loading control. Three independent experiments per protein were

                                   2+
              Cytosolic Ca that is used for skeletal muscle contraction is supplied from the extracellular space as well                                                                                                                                                                                            conducted. The expression level of each protein normalized to the mean
                                                                                                                                                                                                                                                                                                                    value of the vector control is presented as histograms (mean ± SEM for
              as from the SR [1,2,12,13]. Store-operated Ca entry (SOCE) is a method for extracellular Ca to enter                                                                                                                                                                                                  three independent experiments, Supplementary Table S4). There was no
                                                                                          2+
                                                                                                                                                                         2+
              into skeletal myotubes. Stromal interaction molecule 1 (STIM1, a Ca2 sensor on the SR membrane) and                                                                                                                                                                                                   significant difference in the expression level of them. (E) SOCE was
                                                                                                                                +
              Orai1 (an extracellular Ca                  2+  entry channel on the t-tubule membrane) are the main SOCE-mediating                                                                                                                                                                                   measured in the myotubes by depleting the SR with TG in the absence
                                                                                                                                                                                                                                                                                                                                                                                  2+
                                                                                                                                                                                                                                                                                                                    of extracellular Ca and applying extracellular Ca to the myotubes.
                                                                                                                                                                                                                                                                                                                                           2+
              proteins. In short, during skeletal SOCE, STIM1 senses the depletion of Ca from the SR and then                                                                                                                                                                                                       The results are summarized as histograms for the area under the peak
                                                                                                                                                2+
              interacts with Orai1 to form functional puncta. Punctum formation activates Orai1 to allow extracellular                                                                                                                                                                                              (left-hand side) or for the slope in the rising phase of SOCE (right-hand                       ▲ Figure 5. 3D structure of human CASQ1 and an adaptation model to situations with repetitive and/or long-
              Ca to enter into the cytosol. In addition to the main role of Orai1 and STIM1 in SOCE, other proteins                                                                                                                                                                                                 side). There was no significant difference in the slopes of the myotubes.                       term contractions of skeletal muscle: (A) 3D structure of human CASQ1 (PDB ID: 3UOM, starting from 3 to 387
                   2+
                                                                                                                                                                                                                                                                                                                    (F) Ca
                                                                                                                                                                                                                                                                                                                            2+
                                                                                                                                                                                                                                                                                                                               amount in the SR was measured in the myotubes by treatment
              also participate in skeletal SOCE [1,2,14]. Canonical-type transient receptor potential cation channels                                                                                                                                                                                               with TG in the absence of extracellular Ca                 2+  . The results are                amino acids) is presented as a ribbon diagram. The C1 region of CASQ1, which is involved in binding to STIM2, is
                                                                                                                                                                                                                                                                                                                                                                                                                    colored yellow. N or C indicates the N- or C-terminus, respectively. The right images are the 180° rotated images of the
                                                2+
              (TRPCs) mediate Ca entry via the SOCE mechanism [15-18]. STIM2 is a homolog of STIM1 and plays                                                                                                                                                                                                        summarized as histograms for the area under the peak. A representative                          left images along the vertical axis. Images in the lower panel are the top view of the images in the upper panel. (B) The
              redundant roles, to some degree, in SOCE and the terminal differentiation of skeletal muscle [19-22].                                                                                                                                                                                                 trace for each group is shown (E and F). The experimental mean values                           overall results of this study are summarized as schematic diagrams in the upper panel. In the lower panel, ‘an adaptation
                                                                                                                                                                                                                                                                                                                    were normalized to the mean values of the vector control (E and F). (G)
              However, few studies have investigated the roles of STIM2 in skeletal muscle.                                                                                                                                                                                                                         Cytosolic Ca    2+  levels at rest were measured in the myotubes, and the                       model to situations with repetitive and/or long-term contractions of skeletal muscle’, such as tetanic stimulation or
                                                                                                                                                                                                                                                                                                                                                                                                                    fatigue, is presented.
                                                                                                                                                                                                                                                                                                                    mean values are summarized as histograms. The values are presented as
              CASQ1, the major isoform in adult fast-twitch skeletal muscles, is enriched in the SR [23]. CASQ1                                                                                                                                                                                                     the mean ± SEM for the number of myotubes shown in parentheses in

                                                                                                                                                                                                                                                                                                                              *
              buffers Ca        2+  in the SR with a low-affinity and high-capacity Ca -binding ability (40~50 moles or                                                                                                                                                                                             Table 1. Significant difference compared with vector control (p < 0.05).
                                                                                                                              2+
                                                          2+
              maximum ~80 moles of Ca /1 mole of CASQ1) [23,24]. This ability is important for both the preparation
              of rapidly releasable Ca               2+  from the SR during skeletal muscle contraction and for the efficient uptake of                                                                                                                                                                              ◀ Figure 3. Intracellular Ca               2+  release for                                               Vector control     WT CASQ1              C1                                                 PCR primers (EcoR Ⅰ & Xho Ⅰ)

                   2+
              Ca to the SR during skeletal muscle relaxation, which occurs without harmful osmotic effects due to the                                                                                                                                                                                                skeletal muscle contraction, expression levels of                      Width of myotubes                   1.00 ± 0.07       0.97 ± 0.08      1.04 ± 0.10            GST-CASQ1       Forward      5’–GGAATTCATGGGGGCCAGAGCAGTG–3’
                                                                                                                                                                                                                                                                                                                     various proteins, and coimmunoprecipitation of
                                                                                                                                                                                                                                                                                                                                                                                                                                   (30)
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       (30)
                                                                                                                                                                                                                                                                                                                                                                                                                                                     (30)
                                                                                                         2+
                                                                                                                                                                        2+
                                              2+
              storage of high [Ca ] in the SR. In addition to the Ca -buffering ability, CASQ1 has a Ca -sensing                                                                                                                                                                                                     Orai1 with STIM2: KCl (A) or caffeine (B) was                                              Peak area       1.00 ± 0.08       0.69 ± 0.11 *    0.76 ± 0.10 *                          Backward     5’–CGCTCGAGCTAGTCGTCGTCATCATC–3’
                                                                                                                                                                                                                                                                                                                                                                                                                                                     (50)
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       (50)
                                                                                                                                                                                                                                                                                                                                                                                                                                   (50)
              ability. CASQ1 senses the degree of Ca                          2+  depletion from the SR and modulates Ca                             2+  release from the SR                                                                                                                                         applied to the myotubes, and intracellular Ca               2+         SOCE                Slope           1.00 ± 0.07       1.03 ± 0.09      1.02 ± 0.09            GST-A           Forward      5’–GGAATTCATGGGGGCCAGAGCAGTG–3’
                                                                                                                                                                                                                                                                                                                     release from the SR to the cytosol through RyR1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       (30)
                                                                                                                                                                                                                                                                                                                                                                                                                                                     (30)
                                                                                                                                                                                                                                                                                                                                                                                                                                   (30)
              to the cytosol via RyR1 in a conformation (i.e., polymerization)-dependent manner [25,26].                                                                                                                                                                                                             was measured. A representative trace for each                                                              1.00 ± 0.08       1.45 ± 0.06 *    1.24 ± 0.08 *                          Backward     5’–CGCTCGAGCTACATCTCCATCCATATG–3’
                                                                                                                                                                                                                                                                                                                                                                                                         2+
                                                                                                                                                                                                                                                                                                                     group is shown. Histograms show the normalized                         Releasable Ca level from the SR        (50)              (50)              (50)               GST-B           Forward      5’–GGAATTCGATAACGAGGAGGACCTG–3’
              Dysregulation of SOCE and/or mutations of CASQ1 have been reported in human patients or animal                                                                                                                                                                                                         peak amplitude (left-hand side) or the slope in the                    Resting [Ca ] cytosol , nM         94.33 ± 9.23         67.09 ± 9.15 *  74.13 ± 8.48 *                        Backward     5’–CGCTCGAGCTAGTCGTCGTCATCATC–3’
                                                                                                                                                                                                                                                                                                                                                                                                       2+
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       (50)
                                                                                                                                                                                                                                                                                                                                                                                                                                                     (50)
                                                                                                                                                                                                                                                                                                                                                                                                                                   (50)
              models with skeletal muscle diseases such as tubular aggregate myopathy (TAM) or malignant                                                                                                                                                                                                             rising phase of the peak to the mean value of the                                          Peak area       1.00 ± 0.04       1.19 ± 0.05 *    1.12 ± 0.04 *          GST-C           Forward      5’–GGAATTCATGGGGGCCAGAGCAGTG–3’
                                                                                                                                                                                                                                                                                                                     vector control (right-hand side). There was no
                                                                                                                                                                                                                                                                                                                                                                                                                                   (50)
                                                                                                                                                                                                                                                                                                                                                                                                                                                     (50)
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       (50)
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          Backward
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       5’–CGCTCGAGCTAAATCAACTCTACAG–3’
              hyperthermia [23,27-30]. The involvement of STIM1 and/or STIM2 in various human diseases, including                                                                                                                                                                                                    significant difference in the slopes of the myotubes.                   KCl response       Slope           1.00 ± 0.07       1.03 ± 0.08      1.02 ± 0.10                            Forward      5’–GGAATTCGAAGGTGAACGAGAGC–3’
                                                                                                                                                                                                                                                                                                                                                                                                                                                     (30)
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       (30)
                                                                                                                                                                                                                                                                                                                                                                                                                                   (30)
              skeletal muscle diseases, has also been reported [1,2,31-33]. It was reported that the C-terminus of CASQ1                                                                                                                                                                                             The results are presented as the mean ± SEM for                                            Peak area       1.00 ± 0.06       1.32 ± 0.05 *    1.25 ± 0.06 *          GST-D           Backward     5’–CGCTCGAGCTACTCTAAGAACTC–3’
                                                                                                                                                                                                                                                                                                                     the number of myotubes shown in parentheses in
                                                                                                                                                                                                                                                                                                                                                                                                                                                     (50)
                                                                                                                                                                                                                                                                                                                                                                                                                                   (50)
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       (50)
              binds to STIM1 and inhibits SOCE in heterologous expression systems or C2C12 myotubes [27,34,35].                                                                                                                                                                                                      Table 1. (C) The myotube lysate was subjected to                       Caffeineresponse    Slope           1.00 ± 0.07       0.99 ± 0.11      0.98 ± 0.10            GST-E           Forward      5’–GGAATTCACTCTCAAGGCTGTGG–3’
              However, the existence of an interaction between CASQ1 and STIM2 and the functional relevance of                                                                                                                                                                                                       immunoblot assays with antibodies against fifteen                                                             (30)              (30)              (30)                               Backward     5’–CGCTCGAGCTAGTCGTCGTCATCATC–3’
              CASQ1 in conjunction with STIM2 in skeletal muscle remain unknown.                                                                                                                                                                                                                                     proteins. α-actin was used as a loading control.                     ▲ Table 1. Properties of mouse primary skeletal myotubes that                                  ▲ Supplementary Table S1. PCR primers for the cloning of GST-
                                                                                                                                                                                                                                                                                                                     Three independent experiments per protein were
                                                                                                                                                                                                                                                                                                                     conducted. CASQ1, endogenous CASQ1; JP,                              expressed the WT CASQ1 or the C1 region. The values, except for those                          CASQ1 or GST-CASQ1 regions (GST-A to GST-E)
              Therefore, the present study is focused on verifying whether CASQ1 binds to STIM2 using biochemical                                                                                                                                                                                                    junctophilin. The expression level of each protein                   of the cytosolic Ca   2+  levels at rest, were normalized to the mean value of
              approaches, identifying STIM2-binding region on CASQ1 if CASQ1 binds to STIM2, and examining the                                                                                                                                                                                                       normalized to the mean value of the vector control                   those from the vector control. The values are presented as the mean ± SEM                                                     PCR primers (EcoR Ⅰ & Xho Ⅰ)
                                                                                                                                                                                                                                                                                                                                                                                                                                                      *
                                                                                                                                                                                                                                                                                                                                                                                          for the number of myotubes shown in parentheses. Significant difference
              functional relevance of the CASQ1-STIM2 interaction in skeletal muscle using mouse primary skeletal                                                                                                                                                                                                    is presented as histograms (mean ± SEM for three                     compared with vector control (p < 0.05).                                                        GST-C1     Forward       5’–GGAATTCATGGGGGCCAGAGCAGTG–3’
                                                                                                                                                                                                                                                                                                                     independent experiments, Supplementary Table S4).
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   5’ –CGCTCGAGCTACAGGATTAG–3’
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     Backward
              myotubes (instead of a heterologous expression system involving variations in expression and artifacts),                                                                                                                                                                                               * Significant difference compared with vector                                                                                                                                   Forward       5’–GGAATTCGAGTTAGCAG–3’
              single-myotube Ca imaging experiments, and transmission electron microscopy (TEM) observations.                                                                                                                                                                                                        control     (p   <    0.05).     # Significant    difference                                                                                                         GST-C2     Backward      5’–CGCTCGAGCTAAATCAACTCTACAG–3’
                                            2+
                                                                                                                                                                                                                                                                                                                     compared with WT CASQ1 (p < 0.05). (D) The                                                                                                                                      Forward       5’–GGAATTCATGGGGGCCAGAGCAGTG–3’
                                                                                                                                                                                                                                                                                                                     myotube        lysate      was       subjected       to      a                                                                                                       GST-C3
                                                                                                                                                                                                                                                                                                                     coimmunoprecipitation          assay     with     anti-Orai1                                            Vector control    WT CASQ1               C1                             Backward      5’–CGCTCGAGCTAATCCTTCTCTGAGTC–3’
                                                                                                                                                                                                                                                                                                                     antibody, and the immunoprecipitate was subjected                      Length of swelling mitochondria    1.00± 0.07      0.93  ±  0.09     0.38   ± 0.06 *,  #      GST-C4     Forward       5’–GGAATTCGCAGCTGTGGCCAAGAAA–3’
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   5’–CGCTCGAGCTACTCGCCGTCATATTC–3’
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     Backward
                                                                                                                                                                                                                                                                                                                                                                                                                                                   (37)
                                                                                                                                                                                                                                                                                                                                                                                                                                  (53)
         REFERENCES                                                                                                                                                                                                                                                                                                  to immunoblot analysis with anti-Orai1 or anti-                        Expression level of Drp-1         1.00 ± 0.00       1.01 ± 0.05      1.39   ± 0.18 *,  #                 Forward       5’–GGAATTCTTTTCTGCAGAC–3’
                                                                                                                                                                                                                                                                                                                                                                                                                                                                      (35)
                                                                                                                                                                                                                                                                                                                     STIM2 antibody. ‘Myotube lysate’ in the left-hand
                                                                                                                                                                                                                                                                                                                                                                                                                                                                      (3)
                                                                                                                                                                                                                                                                                                                                                                                                                                                    (3)
                                                                                                                                                                                                                                                                                                                                                                                                                                  (3)
                                                                                                                                                                                                                                                                                                                     side indicates a simple immunoblot of the myotube                                                        1.00 ± 0.00       1.00 ± 0.04       1.03 ±  0.05            GST-C5     Backward      5’–CGCTCGAGCTAAATCAACTCTACAG–3’
                                                                                                                                                                                                                                                                                                                     lysate. ‘Without anti-Orai1 Ab’ indicates a reaction                   Expression level of Mfn-1             (3)               (3)               (3)                 ▲ Supplementary Table S2. PCR primers for the cloning of
                                                                                                                                                                                                                                                                                                                     without anti-Orai1 antibody. Three independent                                                                                                                       GST-C regions (GST-C1 to GST-C5)
             1.  Cho, C.H.; Woo, J.S.; Perez, C.F.; Lee, E.H. A focus on extracellular Ca entry into skeletal muscle. Exp Mol Med 2017, 49, e378.                                                                                                                                                                    experiments were conducted, and a representative
                                                                              2+
             2.  Cho, C.H.; Lee, K.J.; Lee, E.H. With the greatest care, stromal interaction molecule (STIM) proteins verify what skeletal muscle is doing. BMB Rep 2018, 51, 378-387.                                                                                                                                                                                                     ▲ Table 2. Length of mitochondria and expression level of Drp-1 or Mfn-
                            2+
             3.  Lee, E.H. Ca channels and skeletal muscle diseases. Prog Biophys Mol Biol 2010, 103, 35-43.                                                                                                                                                                                                         result      is     presented.       The       degree       of         1 in mouse primary skeletal myotubes that expressed the WT CASQ1 or
                                                                    2+
             4.  Zucchi, R.; Ronca-Testoni, S. The sarcoplasmic reticulum Ca channel/ryanodine receptor: modulation by endogenous effectors, drugs and disease states. Pharmacol Rev 1997, 49, 1-51.                                                                                                                 coimmunoprecipitated STIM2 (i.e., the degree of                       C1 region. The values are presented as the mean ± SEM for the number of                                                         PCR primers (EcoR I & Sal I)
             5.  Lee, E.H.; Kim, D.H.; Allen, P.D. Interplay between intra- and extracellular calcium ions. Mol Cells 2006, 21, 315-329.
             6.  Boncompagni, S.; Rossi, A.E.; Micaroni, M.; Beznoussenko, G.V.; Polishchuk, R.S.; Dirksen, R.T.; Protasi, F. Mitochondria are linked to calcium stores in striated muscle by developmentally regulated                                                                                              coimmunoprecipitated STIM2 to total STIM2)                            mitochondria or experiments shown in parentheses. The values were                                              Forward      5’-GGAATTCATGGGGGCCAGAGCAGTG-3’
                                                                                                                                                                                                                                                                                                                                                                                                                                                         *
                 tethering structures. Mol Biol Cell 2009, 20, 1058-1067.                                                                                                                                                                                                                                            normalized to the mean value of the vector control                    normalized to the mean values of the vector control. Significant difference                      C1 region
             7.  Rossi, A.E.; Boncompagni, S.; Wei, L.; Protasi, F.; Dirksen, R.T. Differential impact of mitochondrial positioning on mitochondrial Ca 2+  uptake and Ca 2+  spark suppression in skeletal muscle. Am J                                                                                             is presented as histograms. IB, IP, or Ab indicates                   compared with vector control (p < 0.05). Significant difference compared                                       Backward     5’-GCGTCGACTCACAGGATTAGCTCC-3’
                                                                                                                                                                                                                                                                                                                                                                                                                                             #
                 Physiol Cell Physiol 2011, 301, C1128-1139.
                                                  ++
                                                                                                       ++
             8.  Shamoo, A.E.; MacLennan, D.H. A Ca -dependent and -selective ionophore as part of the Ca ++  + Mg -dependent adenosinetriphosphatase of sarcoplasmic reticulum. Proc Natl Acad Sci U S A 1974,                                                                                                      immunoblot, immunoprecipitation, or antibody,                         with WT CASQ1 (p < 0.05).                                                                      ▲ Supplementary Table S3. PCR primers for the cloning of the C1
                 71, 3522-352.                                                                                                                                                                                                                                                                                       respectively. Significant difference was compared
                                                                                                                                                                                                                                                                                                                                     *
             9.  Takeshima, H.; Komazaki, S.; Nishi, M.; Iino, M.; Kangawa, K. Junctophilins: a novel family of junctional membrane complex proteins. Mol Cell 2000, 6, 11-22.                                                                                                                                                                                                                                                                                                            region into the pCMS-RFP vector
                                                                                                                                                                         2+
             10. Woo, J.S.; Cho, C.H.; Lee, K.J.; Kim, D.H.; Ma, J.; Lee, E.H. Hypertrophy in skeletal myotubes induced by junctophilin-2 mutant, Y141H, involves an increase in store-operated Ca entry via Orai1. J                                                                                                with vector control (p < 0.05).
                 Biol Chem 2012, 287, 14336-48.
             11. Nishi, M.; Komazaki, S.; Kurebayashi, N.; Ogawa, Y.; Noda, T.; Iino, M.; Takeshima, H. Abnormal features in skeletal muscle from mice lacking mitsugumin29. J Cell Biol 1999, 147, 1473-1480.
                                                                                          2+
             12. Feske, S. ORAI1 and STIM1 deficiency in human and mice: roles of store-operated Ca entry in the immune system and beyond. Immunol Rev 2009, 231, 189-209.
             13. Prakriya, M.; Lewis, R.S. Store-Operated Calcium Channels. Physiol Rev 2015, 95, 1383-1436.
             14. Pan, Z.; Brotto, M.; Ma, J. Store-operated Ca entry in muscle physiology and diseases. BMB Rep 2014, 47, 69-79.
                                                       2+
             15. Zanou, N.; Shapovalov, G.; Louis, M.; Tajeddine, N.; Gallo, C.; Van Schoor, M.; Anguish, I.; Cao, M.L.; Schakman, O.; Dietrich, A., et al. Role of TRPC1 channel in skeletal muscle function. Am J
                 Physiol Cell Physiol 2010, 298, C149-162, doi:10.1152/ajpcell.00241.2009.
             16. Lee, E.H.; Cherednichenko, G.; Pessah, I.N.; Allen, P.D. Functional coupling between TRPC3 and RyR1 regulates the expressions of key triadic proteins. J Biol Chem 2006, 281, 10042-8.
             17. Choi, J.H.; Jeong, S.Y.; Oh, M.R.; Allen, P.D.; Lee, E.H. TRPCs: Influential Mediators in Skeletal Muscle. Cells 2020, 9.850.                                                        MATERI ALS  &  METHODS
             18. Kiselyov, K.; Patterson, R.L. The integrative function of TRPC channels. Front Biosci (Landmark Ed) 2009, 14, 45-58.
             19. Hoth, M.; Niemeyer, B.A. The neglected CRAC proteins: Orai2, Orai3, and STIM2. Curr Top Membr 2013, 71, 237-71.
             20. Darbellay, B.; Arnaudeau, S.; Ceroni, D.; Bader, C.R.; Konig, S.; Bernheim, L. Human muscle economy myoblast differentiation and excitation-contraction coupling use the same molecular partners,
                 STIM1 and STIM2. J Biol Chem 2010, 285, 22437-47.
             21. Phuong, T.T.T.; Kang, T.M. Stromal interaction molecule 2 regulates C2C12 myoblast differentiation. Integr Med Res 2015, 4, 242-248.                                                       Ethical approval
                                                                                                                                    2+
                                                                                                                  2+
             22. Oh, M.R.; Lee, K.J.; Huang, M.; Kim, J.O.; Kim, D.H.; Cho, C.H.; Lee, E.H. STIM2 regulates both intracellular Ca distribution and Ca movement in skeletal myotubes. Sci Rep 2017, 7, 17936.
             23. Woo, J.S.; Jeong, S.Y.; Park, J.H.; Choi, J.H.; Lee, E.H. Calsequestrin: a well-known but curious protein in skeletal muscle. Exp Mol Med 2020, 52, 1908-1925.                             The methods were carried out in accordance with the regulations and guidelines of the College of Medicine at The Catholic University of Korea. The site where the animal work took place and all surgical interventions, including pre- and postsurgical animal care, were carried out in accordance with the Laboratory Animals Welfare Act, the Guide for Care and Use of Laboratory Animals, and the
             24. MacLennan, D.H.; Wong, P.T. Isolation of a calcium-sequestering protein from sarcoplasmic reticulum. Proc Natl Acad Sci U S A 1971, 68, 1231-1235.                                         Guidelines and Policies for Rodent Survival Surgery approved by the Institutional Animal Care and Use Committee of the College of Medicine at The Catholic University of Korea. All protocols for the experiments were approved by the Committee of the College of Medicine at The Catholic University of Korea.
             25. Wei, L.; Varsanyi, M.; Dulhunty, A.F.; Beard, N.A. The conformation of calsequestrin determines its ability to regulate skeletal ryanodine receptors. Biophys J 2006, 91, 1288-1301.
             26. Park, H.; Wu, S.; Dunker, A.K.; Kang, C. Polymerization of calsequestrin. Implications for Ca regulation. J Biol Chem 2003, 278, 16176-16182.                                              cDNA construction and expression of the GST-CASQ1 or GST-CASQ1 regions
                                                                                                2+
                                                                                                                                                              2+
             27. Shin, D.W.; Pan, Z.; Kim, E.K.; Lee, J.M.; Bhat, M.B.; Parness, J.; Kim, D.H.; Ma, J. A retrograde signal from calsequestrin for the regulation of store-operated Ca entry in skeletal muscle. J Biol  cDNA of mouse CASQ1 was obtained from OriGene Technologies, Inc. (Rockville, MD, USA, #MR206274). To prepare cDNA for GST-tagged full-length CASQ1 (GST-CASQ1) or CASQ1 regions, oligonucleotide primers were designed on the basis of mouse CASQ1 (GenBank accession number: NM_009813) (Supplementary Tables S1 and S2). With the primers, PCR was performed (30
                 Chem 2003, 278, 3286-3292.                                                                                                                                                                 cycles at 95 °C for 45 s, 63 °C for 45 s, and 68 °C for 90 s). The PCR products were subcloned into the pGEX-4T-1 vector. GST-CASQ1 or GST-CASQ1 regions were expressed in E. coli (DH5α) using 0.1 mM isopropyl-β-D-thiogalactopyranoside (Sigma–Aldrich, St. Louis, MO, U.S.A.), as previously described [22,36,37]. For expressing the full-length wild-type CASQ1 (WT CASQ1) in
             28. Yarotskyy, V.; Protasi, F.; Dirksen, R.T. Accelerated activation of SOCE current in myotubes from two mouse models of anesthetic- and heat-induced sudden death. PLoS One 2013, 8, e77633.  mouse primary skeletal myotubes, full-length CASQ1 in the pGEX-4T-1 vector was subcloned into the pCMS-RFP vector using EcoR I and Not I enzyme sites. For the C1 region, the PCR products using primers in Supplementary Table S3 were subcloned into the pCMS-RFP vector.
             29. Lewis, K.M.; Ronish, L.A.; Rios, E.; Kang, C. Characterization of Two Human Skeletal Calsequestrin Mutants Implicated in Malignant Hyperthermia and Vacuolar Aggregate Myopathy. J Biol Chem
                 2015, 290, 28665-28674.
             30. Barone, V.; Del Re, V.; Gamberucci, A.; Polverino, V.; Galli, L.; Rossi, D.; Costanzi, E.; Toniolo, L.; Berti, G.; Malandrini, A., et al. Identification and characterization of three novel mutations in the  Triad sample preparation and the binding assay of CASQ1 regions with triad proteins
                                                                                                                                                                                                                                                                                          2+
                 CASQ1 gene in four patients with tubular aggregate myopathy. Hum Mutat 2017, 38, 1761-1773.                                                                                                Triad vesicles (that are enriched with triad proteins mediating intra- and extracellular Ca movements in skeletal muscle, including STIM2 [1-3,5]) were prepared and solubilized to create triad samples, as previously described [38-41]. Binding assays were performed as previously described [37]. Briefly, affinity beads were prepared by immobilizing the GST-CASQ1 or GST-CASQ1 regions on
             31. Cendula, R.; Dragun, M.; Gazova, A.; Kyselovic, J.; Hulman, M.; Matus, M. Changes in STIM isoforms expression and gender-specific alterations in Orai expression in human heart failure. Physiol Res  GST beads (Amersham, GE Healthcare Biosciences, Pittsburgh, PA). The affinity beads were then incubated with 150 μg of the triad sample for 6 h at 4 °C. The proteins that were bound to the affinity beads were separated on a 10% SDS–PAGE gel and subjected to an immunoblot assay.
                 2019, 68, S165-S172.
             32. Spinelli, A.M.; Trebak, M. Orai channel-mediated Ca signals in vascular and airway smooth muscle. Am J Physiol Cell Physiol 2016, 310, C402-413.                                           Cell culture and expression of the WT CASQ1 or C1 region
                                                              2+
             33. Berna-Erro, A.; Jardin, I.; Salido, G.M.; Rosado, J.A. Role of STIM2 in cell function and physiopathology. J Physiol 2017, 595, 3111-3128, doi:10.1113/JP273889.                           Mouse primary skeletal myoblasts that were derived from mouse skeletal muscle using a single-cell cloning method were expanded and differentiated into myotubes, as previously described [41-45]. For differentiating the skeletal myoblasts to myotubes, myoblasts were replated on different plates coated with Matrigel (BD Biosciences, Sparks Glencoe, MD, U.S.A., 6-well plates for the TEM
             34. Zhang, L.; Wang, L.; Li, S.; Xue, J.; Luo, D. Calsequestrin-1 Regulates Store-Operated Ca Entry by Inhibiting STIM1 Aggregation. Cell Physiol Biochem 2016, 38, 2183-2193.                 observation or immunocytochemistry experiment, 96-well plates for the single-myotube Ca imaging experiment, or 10-cm plates for other experiments). After three days of culture under differentiation conditions, premature myotubes were transfected with an empty vector as a control or cDNA encoding the WT CASQ1 or C1 region (a mixture of 30 µl of FuGENE6 (Promega, Madison, WI,
                                                                                             2+
                                                                                                                                                                                                                                                                                             2+
                                                                                                                                                              2+
             35. Wang, L.; Zhang, L.; Li, S.; Zheng, Y.; Yan, X.; Chen, M.; Wang, H.; Putney, J.W.; Luo, D. Retrograde regulation of STIM1-Orai1 interaction and store-operated Ca entry by calsequestrin. Sci Rep  U.S.A.) and 20 μg of cDNA per 10-cm dish, or the same ratio of components in the well of other plates, for 3 h). Mature myotubes were either observed, imaged, or disrupted at 36 h posttransfection for further experiments, at which time approximately 60% of the myotubes had been transfected, as estimated by the RFP signal. All reagents that were used for the cell cultures were obtained from
                 2015, 5, 11349.                                                                                                                                                                            Invitrogen (Waltham, MA, U.S.A.).
             36. Lee, E.H.; Rho, S.H.; Kwon, S.J.; Eom, S.H.; Allen, P.D.; Kim, D.H. N-terminal region of FKBP12 is essential for binding to the skeletal ryanodine receptor. J Biol Chem 2004, 279, 26481-26488.
                                                                                                                                2+
             37. Lee, K.J.; Park, C.S.; Woo, J.S.; Kim, D.H.; Ma, J.; Lee, E.H. Mitsugumin 53 attenuates the activity of sarcoplasmic reticulum Ca -ATPase 1a (SERCA1a) in skeletal muscle. Biochem Biophys Res
                 Commun 2012, 428, 383-388.                                                                                                                                                                 Coimmunoprecipitation and immunoblot assays
                                                                                                                                                    2+
             38. Lee, K.J.; Hyun, C.; Woo, J.S.; Park, C.S.; Kim, D.H.; Lee, E.H. Stromal interaction molecule 1 (STIM1) regulates sarcoplasmic/endoplasmic reticulum Ca -ATPase 1a (SERCA1a) in skeletal muscle.  Mouse primary skeletal myotubes were solubilized in lysis buffer, as previously described [10,22,38,41,42,44]. For the coimmunoprecipitation assay [22,41,42,44], solubilized myotube lysate (100 µg of total protein) and anti-CASQ1 (Affinity BioReagents, Golden, CO, U.S.A.) or anit-Orai1 antibody (Abcam, Cambridge, MA, U.S.A.) were used. The immunoprecipitate was subjected to
                 Pflugers Arch 2014, 466, 987-1001.                                                                                                                                                         immunoblot assays with anti-CASQ1, anti-Orai1, or anti-STIM2 antibody (Abcam). For the immunoblot assay, solubilized myotube lysate (10 μg of total protein) was subjected to SDS–PAGE (8, 10, or 12% gel) [10,22,38,41,42,44,46]. The anti-RyR1, anti-SERCA1a, anti-CASQ1, anti-CaM1, anti-JP1, and anti-JP2 antibodies were obtained from Affinity BioReagents. The anti-TRPC1, anti-
             39. Saito, A.; Seiler, S.; Chu, A.; Fleischer, S. Preparation and morphology of sarcoplasmic reticulum terminal cisternae from rabbit skeletal muscle. J Cell Biol 1984, 99, 875-885.          TRPC3, anti-TRPC4, and anti-TRPC6 antibodies were obtained from Alomone Laboratories (Jerusalem, Israel). The anti-TRIM32, anti-MyoD, and anti-myogenin antibodies were obtained from Santa Cruz Biotechnology (Dallas, TX, U.S.A.). The anti-DHPR, anti-STIM1, anti-STIM2, and anti-α-actin antibodies were obtained from Abcam.
             40. Woo, J.S.; Kim, D.H.; Allen, P.D.; Lee, E.H. TRPC3-interacting triadic proteins in skeletal muscle. Biochem J 2008, 411, 399-405.
             41. Choi, J.H.; Huang, M.; Hyun, C.; Oh, M.R.; Lee, K.J.; Cho, C.H.; Lee, E.H. A muscular hypotonia-associated STIM1 mutant at R429 induces abnormalities in intracellular Ca 2+  movement and  Immunocytochemistry and width measurement
                 extracellular Ca entry in skeletal muscle. Sci Rep 2019, 9, 19140.                                                                                                                         For the immunocytochemistry experiments, myotubes were fixed in cold methanol (−20 °C) for 30 min, permeabilized with 0.05% Tween 20 phosphate-buffered saline for 1 min, and stained with anti-GFP (for detecting RFP-tagged proteins) and Cy3-conjugated secondary antibodies, as previously described [10,38,41,42,44]. Myotube widths (one criterion that is used to evaluate the degree of
                              2+
             42. Lee, K.J.; Woo, J.S.; Hwang, J.H.; Hyun, C.; Cho, C.H.; Kim, D.H.; Lee, E.H. STIM1 negatively regulates Ca 2+  release from the sarcoplasmic reticulum in skeletal myotubes. Biochem J 2013, 453,  skeletal myotube formation) were measured using the ImageJ program, as previously described [10,38,41,42,45,46].
                 187-200.
             43. Rando, T.A.; Blau, H.M. Methods for myoblast transplantation. Methods Cell Biol 1997, 52, 261-272.                                                                                                          2+
                                                                                                                 2+
             44. Ahn, M.K.; Lee, K.J.; Cai, C.; Huang, M.; Cho, C.H.; Ma, J.; Lee, E.H. Mitsugumin 53 regulates extracellular Ca entry and intracellular Ca 2+  release via Orai1 and RyR1 in skeletal muscle. Sci Rep  Single-myotube Ca imaging
                                                                                                                                                                                                                             2+
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        2+
                 2016, 6, 36909.                                                                                                                                                                            Single-myotube Ca imaging was performed using a high-speed monochromator with a 75 W xenon lamp (FSM150Xe, Bentham Instruments, Reading, Berkshire, U.K.) and an inverted-stage microscope (Nikon Eclipse TS100, Nikon Instruments, Inc., Melville, NY, U.S.A.). Mouse primary skeletal myotubes were loaded with 5 μM fura-2-AM (Invitrogen) for the measurement of cytosolic [Ca ]
                                                                                                                        2+
             45. Woo, J.S.; Hwang, J.H.; Ko, J.K.; Weisleder, N.; Kim, D.H.; Ma, J.; Lee, E.H. S165F mutation of junctophilin 2 affects Ca signalling in skeletal muscle. Biochem J 2010, 427, 125-134.     or fluo-4-AM (Invitrogen) for other measurements in imaging buffer (25 mM HEPES, pH 7.4, 125 mM NaCl, 5 mM KCl, 2 mM KH PO , 2 mM CaCl , 6 mM glucose, 1.2 mM MgSO , and 0.05% BSA) at 37 °C for 45 min, as previously described [10,22,38,41,42,44-46]. Either caffeine (20 mM) or KCl (60 mM) was dissolved in the imaging buffer and applied to myotubes via an autoperfusion
                                                                                                                                                                                                                                                                                                                                                 2
                                                                                                                                                                                                                                                                                                                                 2
                                                                                                                                                                                                                                                                                                                                                                              4
                                                                                                                                                                                                                                                                                                                                     4
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                2+
                                                                                                                                                                                                                                                                                                                                                                            2+
                                                                                                              2+
             46. Huang, M.; Lee, K.J.; Kim, K.J.; Ahn, M.K.; Cho, C.H.; Kim, D.H.; Lee, E.H. The maintenance ability and Ca availability of skeletal muscle are enhanced by sildenafil. Exp Mol Med 2016, 48, e278.  system (AutoMate Scientific, St. Berkeley, CA, U.S.A.). The data were analyzed or displayed using image acquisition and analysis software (High-Speed InCyt Im2 for cytosolic [Ca ] and Im1 for other results, v5.29, Intracellular Imaging Inc., Cincinnati, OH, U.S.A.). To measure releasable Ca from the SR, thapsigargin (TG, 2.5 μM) dissolved in dimethyl sulfoxide (DMSO, < 0.05%, no effect
             47. Madej, T.; Lanczycki, C.J.; Zhang, D.; Thiessen, P.A.; Geer, R.C.; Marchler-Bauer, A.; Bryant, S.H. MMDB and VAST+: tracking structural similarities between macromolecular complexes. Nucleic  by itself) in the absence of extracellular Ca was applied to myotubes. For the SOCE measurement, Ca in the SR was depleted with TG (2.5 μM) in the absence of extracellular Ca , and once the cytosolic Ca level returned to baseline, Ca (2mM) was added to myotubes to measure SOCE. To analyze Ca movement, the peak amplitudes (which exhibited similar changes in peak areas) were
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             2+
                                                                                                                                                                                                                                                                                                                                                                            2+
                                                                                                                                                                                                                                                                                                                                                                                                     2+
                                                                                                                                                                                                                                                  2+
                                                                                                                                                                                                                                                                                                       2+
                                                                                                                                                                                                                                                                                                                                                                                                                                 2+
                 Acids Res 2014, 42, D297-303.                                                                                                                                                              measured. For long-term Ca movements such as SOCE or the response to TG, the area under the curve was analyzed. To analyze the initial rate of responses, the slope at the rising phase of the response was examined by a linear equation that was obtained from a linear fitting of the rising phase [10,22,41,44,45]. Reagents that were used for the single-myotube Ca imaging were obtained from
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               2+
                                                                                                                                                                                                                                     2+
             48. des Georges, A.; Clarke, O.B.; Zalk, R.; Yuan, Q.; Condon, K.J.; Grassucci, R.A.; Hendrickson, W.A.; Marks, A.R.; Frank, J. Structural Basis for Gating and Activation of RyR1. Cell 2016, 167, 145-  Sigma–Aldrich.
                 157 e117.
             49. Nicklas, S.; Otto, A.; Wu, X.; Miller, P.; Stelzer, S.; Wen, Y.; Kuang, S.; Wrogemann, K.; Patel, K.; Ding, H., et al. TRIM32 regulates skeletal muscle stem cell differentiation and is necessary for  TEM observation
                 normal adult muscle regeneration. PLoS One 2012, 7, e30445.
                                                                                                                                       2+
             50. Murphy, R.M.; Larkins, N.T.; Mollica, J.P.; Beard, N.A.; Lamb, G.D. Calsequestrin content and SERCA determine normal and maximal Ca storage levels in sarcoplasmic reticulum of fast- and slow-  For TEM observations, myotubes were fixed, embedded in epoxy resin (Epon 812), sectioned using an ultramicrotome (70–80 nm, Ultracut UCT ultramicrotome, Leica, Buffalo Grove, IL, U.S.A.), and examined under TEM (JEM1010, JEOL Ltd., Peabody, MA, U.S.A.) at 60 kV, as previously described [10,41]. To analyze the length of mitochondria, the mitochondrial length in a unit area
                 twitch fibres of rat. J Physiol 2009, 587, 443-460.                                                                                                                                        (37.5 × 25.0 μm2) was measured using ImageJ software.
                                                                                         2+
             51. Launikonis, B.S.; Murphy, R.M.; Edwards, J.N. Toward the roles of store-operated Ca entry in skeletal muscle. Pflugers Arch 2010, 460, 813-823.
             52. Canato, M.; Scorzeto, M.; Giacomello, M.; Protasi, F.; Reggiani, C.; Stienen, G.J. Massive alterations of sarcoplasmic reticulum free calcium in skeletal muscle fibers lacking calsequestrin revealed by a  Presentation of the three-dimensional (3D) structure of CASQ1For TEM observations, myotubes were fixed, embedded in epoxy resin (Epon 812), sectioned using an ultramicrotome (70–80 nm, Ultracut UCT ultramicrotome, Leica, Buffalo Grove, IL, U.S.A.), and examined under TEM (JEM1010, JEOL Ltd., Peabody, MA, U.S.A.) at 60 kV, as previously described [10,41]. To analyze the
                 genetically encoded probe. Proc Natl Acad Sci U S A 2010, 107, 22326-22331.                                                                                                                length of mitochondria, the mitochondrial length in a unit area (37.5 × 25.0 μm ) was measured using ImageJ software.
                                                                                                                                                                                                                                                                                 2
             53. Makarov, V.I.; Khmelinskii, I.; Khuchua, Z.; Javadov, S. In silico simulation of reversible and irreversible swelling of mitochondria: The role of membrane rigidity. Mitochondrion 2020, 50, 71-81.  The 3D structure of human CASQ1 (PDB ID: 3UOM) is presented as a ribbon diagram using iCn3D (NCBI’s web-based 3D structure viewer) [47].
             54. Lannergren, J.; Bruton, J.D. Mitochondrial Ca in mouse soleus single muscle fibres in response to repeated tetanic contractions. Adv Exp Med Biol 2003, 538, 557-562; discussion 562.
                                                        2+
             55. Sembrowich, W.L.; Quintinskie, J.J.; Li, G. Calcium uptake in mitochondria from different skeletal muscle types. J Appl Physiol (1985) 1985, 59, 137-141.                                  Statistical analysis
             56. Smirnova, E.; Griparic, L.; Shurland, D.L.; van der Bliek, A.M. Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol Biol Cell 2001, 12, 2245-2256.
             57. Budzinska, M.; Zimna, A.; Kurpisz, M. The role of mitochondria in Duchenne muscular dystrophy. J Physiol Pharmacol 2021, 72.157-166.                                                       The results are presented as the mean ± SEM for the number of myotubes or experiments shown in the figure legends or the table parentheses. Significant differences were analyzed using unpaired t-test (for Figures 1A and 2B) or one-way ANOVA (for others) (GraphPad InStat, v2.04, GraphPad Software, San Diego, CA, U.S.A.). The differences were considered to be significant for p < 0.05. The
             58. Wang, S.; Trumble, W.R.; Liao, H.; Wesson, C.R.; Dunker, A.K.; Kang, C.H. Crystal structure of calsequestrin from rabbit skeletal muscle sarcoplasmic reticulum. Nat Struct Biol 1998, 5, 476-483.  graphs were prepared using Origin 2019b (OriginLab, Northampton, MA, U.S.A.).
   1   2   3   4   5   6   7   8   9   10

 

 

 

 

 

이북나라전자책·플립북 제작원본 전자책으로 보기
내 문서도 이렇게 만들 수 있습니다
PDF 원본만 보내주시면 페이지가 넘어가는 전자책(플립북)으로 제작해 드립니다. 카탈로그·사보·브로슈어·보고서 등 11개 산업에서 1,500건 이상 제작했습니다.
무료 견적 받기제작 사례 보기