Page 5 - ebook
P. 5
Calsequestrin 1 Is an Active Partner
of Stromal Interaction Molecule 2 in Skeletal Muscle
Seung Yeon Jeong 1,2 , Mi Ri Oh 1,2 , Jun Hee Choi 1,2 , Jin Seok Woo , and Eun Hui Lee 1,2,*
3
1 Department of Physiology, College of Medicine, The Catholic University of Korea, Seoul 06591
2 Department of Biomedicine & Health Sciences, Graduate School, The Catholic University of Korea, Seoul 06591
3 Department of Physiology, David Geffen School of Medicine, UCLA, Los Angeles, CA 10833, USA
*Correspondence: ehui@catholic.ac.kr
ABSTRACT RESULTS
2+
Calsequestrin 1 (CASQ1) in skeletal muscle buffers and senses Ca in the sarcoplasmic reticulum (SR).
CASQ1 also regulates store-operated Ca 2+ entry (SOCE) by binding to stromal interaction molecule 1 ◀ Figure 1. Coimmunoprecipitation of CASQ1 with STIM2 and ◀ Figure 4. Abnormal mitochondria
(STIM1). Abnormal SOCE and/or abnormal expression or mutations in CASQ1, STIM1, or STIM2 are the binding assay of CASQ1 regions to STIM2: (A) Triad samples in the shape and the expression level
associated with human skeletal, cardiac, or smooth muscle diseases. However, the functional relevance of obtained from rabbit skeletal muscle were subjected to a of Drp-1 or Mfn-1: (A) Mitochondria
coimmunoprecipitation assay with anti-CASQ1 antibody. ‘Triad sample’
CASQ1 along with STIM2 has not been studied in any tissue, including skeletal muscle. First, in the indicates a simple immunoblot of the triad sample. ‘Without anti- in the myotubes were observed using
TEM. Areas in the numbered boxes
present study, it was found by biochemical approaches that CASQ1 bound to STIM2 via its 92 N-terminal CASQ1 Ab’ indicates a reaction without anti-CASQ1 antibody. Three (from 1 to 3) were enlarged. Swelling
amino acids (C1 region). Next, to examine the functional relevance of the CASQ1-STIM2 interaction in independent experiments were conducted, and a representative result is mitochondria were found in C1-
presented. The degree of coimmunoprecipitated STIM2 to total STIM2
skeletal muscle, the full-length wild-type CASQ1 or the C1 region was expressed in mouse primary is presented as histograms. STIM2 was successfully expressing myotubes. The bar
represents 2 μm. (B) The length of the
skeletal myotubes, and the myotubes were examined using single-myotube Ca 2+ imaging experiments and coimmunoprecipitated with CASQ1. IB, IP, or Ab indicates immunoblot, swelling mitochondria was measured,
*
transmission electron microscopy observations. The CASQ1-STIM2 interaction via the C1 region immunoprecipitation, or antibody, respectively. Significant difference and the results are summarized as
was compared with ‘without anti-CASQ1 Ab’ (p < 0.05). (B and E)
decreased SOCE, increased intracellular Ca 2+ release for skeletal muscle contraction, and changed Schematic diagrams of mouse CASQ1 regions are presented. Numbers h i sto gr ams . T h e v alu es wer e
normalized to the mean values of the
intracellular Ca 2+ distributions (high Ca 2+ in the SR and low Ca 2+ in the cytosol were observed). indicate the sequence of amino acids. The S1B region is presented vector control. The values are presented
Furthermore, the C1 region itself (which lacks Ca 2+ - buffering ability but has STIM2-binding ability) according to a previous report [35]. (C, D and F) The bound proteins as the mean ± SEM for the number of
that were obtained from the binding assays of GST-CASQ1 or
decreased the expression of Ca 2+ -related proteins (canonical-type transient receptor potential cation GSTCASQ1 regions with triad samples were subjected to immunoblot mitochondria in Table 2. (C) The
myotube lysate was subjected to
channel type 6 and calmodulin 1) and induced mitochondrial shape abnormalities. Therefore, in skeletal assays with anti-GST (to detect GST-CASQ1 or GST-CASQ1 regions) immunoblot assays with antibody
muscle, CASQ1 plays active roles in Ca movement and distribution by interacting with STIM2 as well as or anti-STIM2 antibody. GST was used as a negative control. Three against Drp-1 or Mfn-1. α-actin was
2+
independent experiments were conducted. The relative amount of
Ca sensing and buffering STIM2 to the corresponding amount of the CASQ1 region is presented used as a loading control. Three
2+
as histograms on the right-hand side. The value for the relative amount independent experiments per protein
were conducted. The expression level
of STIM2 to GST was regarded as 1, and others were normalized by this of each protein normalized to the mean
value. Significant difference compared with GST (p < 0.05). value of the vector control is presented
*
I NTRODUCTI ON as histograms (Table 2). Significant
*
difference compared with vector control
2+
◀ Figure 1. SOCE, Ca amount in the SR, and cytosolic Ca 2+ level (p < 0.05). Significant difference
#
in WT CASQ1 or C1-expressing mouse skeletal myotubes: (A) compared with WT CASQ1 (p < 0.05).
Mouse primary skeletal myotubes that were transfected with cDNA of
Skeletal muscle contracts or relaxes to move the body or to sustain body postures, which is dependent on empty vector (vector control), full-length wild-type CASQ1 (WT
the cytosolic Ca level of myotubes (i.e., skeletal muscle cells) [1-5]. CASQ1), or C1 region (C1) were subjected to immunocytochemistry
2+
using anti-GFP antibodies. The bar represents 100 µm. (B) The lysate
A transient elevation of cytosolic Ca 2+ levels couples action potentials on the t-tubule membrane with of WT CASQ1 or C1-expressing myotubes was subjected to a
skeletal muscle contractions (called excitation-contraction (EC) coupling). During skeletal EC coupling, coimmunoprecipitation assay with anti-CASQ1 antibody, and the
immunoprecipitate was subjected to immunoblot analysis with anti-
2+
dihydropyridine receptor (DHPR, a voltage-gated Ca channel on the t-tubule membrane) is activated by CASQ1 or anti-STIM2 antibody. ‘Myotube lysate’ indicates a simple
sensing action potentials in response to acetylcholine and changes its conformation. Active DHPR immunoblot of the myotube lysate. ‘Without anti-CASQ1 Ab’ indicates
activates ryanodine receptor type 1 (RyR1, an internal Ca 2+ channel on the sarcoplasmic reticulum (SR) a reaction without anti-CASQ1 antibody. Three independent
experiments were conducted, and a representative result is presented.
membrane) via physical interactions. Active RyR1 releases Ca from the SR (an internal Ca Ca store) to The degree of coimmunoprecipitated STIM2 to total STIM2 is
2+
2+
the cytosol, and Ca turns on contractile proteins to evoke skeletal muscle contractions. In addition to the presented as histograms. STIM2 was successfully
2+
major role of the SR of storing internal Ca mitochondria also have a role storing internal Ca in skeletal coimmunoprecipitated with CASQ1. IB, IP, or Ab indicates
2+
2+
antibody,
immunoprecipitation,
or
respectively.
immunoblot,
muscle [6,7]. To relax skeletal muscle, cytosolic Ca moves back to the SR via sarcoplasmic/endoplasmic * Significant difference was compared with ‘without anti-CASQ1 Ab’ (p
2+
2+
reticulum Ca -ATPase1a (SERCA1a, a Ca 2+ pump in the SR membrane) [8]. The coordinated < 0.05). (C) Myotube widths were measured. The normalized mean
arrangement of the proteins mentioned above in the triad junction (which is composed of two t-tubule values of each to the mean value of the vector control are summarized
as histograms. There was no significant difference in the width of the
membranes and an SR between them, such as a sandwich) is required for the transient elevation or myotubes. (D) The myotube lysate was subjected to immunoblot assays
2+
removal of cytosolic Ca during the contraction or relaxation of skeletal muscle [9-11]. with antibody against MyoD or myogenin. α-actin was used as a
loading control. Three independent experiments per protein were
2+
Cytosolic Ca that is used for skeletal muscle contraction is supplied from the extracellular space as well conducted. The expression level of each protein normalized to the mean
value of the vector control is presented as histograms (mean ± SEM for
as from the SR [1,2,12,13]. Store-operated Ca entry (SOCE) is a method for extracellular Ca to enter three independent experiments, Supplementary Table S4). There was no
2+
2+
into skeletal myotubes. Stromal interaction molecule 1 (STIM1, a Ca2 sensor on the SR membrane) and significant difference in the expression level of them. (E) SOCE was
+
Orai1 (an extracellular Ca 2+ entry channel on the t-tubule membrane) are the main SOCE-mediating measured in the myotubes by depleting the SR with TG in the absence
2+
of extracellular Ca and applying extracellular Ca to the myotubes.
2+
proteins. In short, during skeletal SOCE, STIM1 senses the depletion of Ca from the SR and then The results are summarized as histograms for the area under the peak
2+
interacts with Orai1 to form functional puncta. Punctum formation activates Orai1 to allow extracellular (left-hand side) or for the slope in the rising phase of SOCE (right-hand ▲ Figure 5. 3D structure of human CASQ1 and an adaptation model to situations with repetitive and/or long-
Ca to enter into the cytosol. In addition to the main role of Orai1 and STIM1 in SOCE, other proteins side). There was no significant difference in the slopes of the myotubes. term contractions of skeletal muscle: (A) 3D structure of human CASQ1 (PDB ID: 3UOM, starting from 3 to 387
2+
(F) Ca
2+
amount in the SR was measured in the myotubes by treatment
also participate in skeletal SOCE [1,2,14]. Canonical-type transient receptor potential cation channels with TG in the absence of extracellular Ca 2+ . The results are amino acids) is presented as a ribbon diagram. The C1 region of CASQ1, which is involved in binding to STIM2, is
colored yellow. N or C indicates the N- or C-terminus, respectively. The right images are the 180° rotated images of the
2+
(TRPCs) mediate Ca entry via the SOCE mechanism [15-18]. STIM2 is a homolog of STIM1 and plays summarized as histograms for the area under the peak. A representative left images along the vertical axis. Images in the lower panel are the top view of the images in the upper panel. (B) The
redundant roles, to some degree, in SOCE and the terminal differentiation of skeletal muscle [19-22]. trace for each group is shown (E and F). The experimental mean values overall results of this study are summarized as schematic diagrams in the upper panel. In the lower panel, ‘an adaptation
were normalized to the mean values of the vector control (E and F). (G)
However, few studies have investigated the roles of STIM2 in skeletal muscle. Cytosolic Ca 2+ levels at rest were measured in the myotubes, and the model to situations with repetitive and/or long-term contractions of skeletal muscle’, such as tetanic stimulation or
fatigue, is presented.
mean values are summarized as histograms. The values are presented as
CASQ1, the major isoform in adult fast-twitch skeletal muscles, is enriched in the SR [23]. CASQ1 the mean ± SEM for the number of myotubes shown in parentheses in
*
buffers Ca 2+ in the SR with a low-affinity and high-capacity Ca -binding ability (40~50 moles or Table 1. Significant difference compared with vector control (p < 0.05).
2+
2+
maximum ~80 moles of Ca /1 mole of CASQ1) [23,24]. This ability is important for both the preparation
of rapidly releasable Ca 2+ from the SR during skeletal muscle contraction and for the efficient uptake of ◀ Figure 3. Intracellular Ca 2+ release for Vector control WT CASQ1 C1 PCR primers (EcoR Ⅰ & Xho Ⅰ)
2+
Ca to the SR during skeletal muscle relaxation, which occurs without harmful osmotic effects due to the skeletal muscle contraction, expression levels of Width of myotubes 1.00 ± 0.07 0.97 ± 0.08 1.04 ± 0.10 GST-CASQ1 Forward 5’–GGAATTCATGGGGGCCAGAGCAGTG–3’
various proteins, and coimmunoprecipitation of
(30)
(30)
(30)
2+
2+
2+
storage of high [Ca ] in the SR. In addition to the Ca -buffering ability, CASQ1 has a Ca -sensing Orai1 with STIM2: KCl (A) or caffeine (B) was Peak area 1.00 ± 0.08 0.69 ± 0.11 * 0.76 ± 0.10 * Backward 5’–CGCTCGAGCTAGTCGTCGTCATCATC–3’
(50)
(50)
(50)
ability. CASQ1 senses the degree of Ca 2+ depletion from the SR and modulates Ca 2+ release from the SR applied to the myotubes, and intracellular Ca 2+ SOCE Slope 1.00 ± 0.07 1.03 ± 0.09 1.02 ± 0.09 GST-A Forward 5’–GGAATTCATGGGGGCCAGAGCAGTG–3’
release from the SR to the cytosol through RyR1
(30)
(30)
(30)
to the cytosol via RyR1 in a conformation (i.e., polymerization)-dependent manner [25,26]. was measured. A representative trace for each 1.00 ± 0.08 1.45 ± 0.06 * 1.24 ± 0.08 * Backward 5’–CGCTCGAGCTACATCTCCATCCATATG–3’
2+
group is shown. Histograms show the normalized Releasable Ca level from the SR (50) (50) (50) GST-B Forward 5’–GGAATTCGATAACGAGGAGGACCTG–3’
Dysregulation of SOCE and/or mutations of CASQ1 have been reported in human patients or animal peak amplitude (left-hand side) or the slope in the Resting [Ca ] cytosol , nM 94.33 ± 9.23 67.09 ± 9.15 * 74.13 ± 8.48 * Backward 5’–CGCTCGAGCTAGTCGTCGTCATCATC–3’
2+
(50)
(50)
(50)
models with skeletal muscle diseases such as tubular aggregate myopathy (TAM) or malignant rising phase of the peak to the mean value of the Peak area 1.00 ± 0.04 1.19 ± 0.05 * 1.12 ± 0.04 * GST-C Forward 5’–GGAATTCATGGGGGCCAGAGCAGTG–3’
vector control (right-hand side). There was no
(50)
(50)
(50)
Backward
5’–CGCTCGAGCTAAATCAACTCTACAG–3’
hyperthermia [23,27-30]. The involvement of STIM1 and/or STIM2 in various human diseases, including significant difference in the slopes of the myotubes. KCl response Slope 1.00 ± 0.07 1.03 ± 0.08 1.02 ± 0.10 Forward 5’–GGAATTCGAAGGTGAACGAGAGC–3’
(30)
(30)
(30)
skeletal muscle diseases, has also been reported [1,2,31-33]. It was reported that the C-terminus of CASQ1 The results are presented as the mean ± SEM for Peak area 1.00 ± 0.06 1.32 ± 0.05 * 1.25 ± 0.06 * GST-D Backward 5’–CGCTCGAGCTACTCTAAGAACTC–3’
the number of myotubes shown in parentheses in
(50)
(50)
(50)
binds to STIM1 and inhibits SOCE in heterologous expression systems or C2C12 myotubes [27,34,35]. Table 1. (C) The myotube lysate was subjected to Caffeineresponse Slope 1.00 ± 0.07 0.99 ± 0.11 0.98 ± 0.10 GST-E Forward 5’–GGAATTCACTCTCAAGGCTGTGG–3’
However, the existence of an interaction between CASQ1 and STIM2 and the functional relevance of immunoblot assays with antibodies against fifteen (30) (30) (30) Backward 5’–CGCTCGAGCTAGTCGTCGTCATCATC–3’
CASQ1 in conjunction with STIM2 in skeletal muscle remain unknown. proteins. α-actin was used as a loading control. ▲ Table 1. Properties of mouse primary skeletal myotubes that ▲ Supplementary Table S1. PCR primers for the cloning of GST-
Three independent experiments per protein were
conducted. CASQ1, endogenous CASQ1; JP, expressed the WT CASQ1 or the C1 region. The values, except for those CASQ1 or GST-CASQ1 regions (GST-A to GST-E)
Therefore, the present study is focused on verifying whether CASQ1 binds to STIM2 using biochemical junctophilin. The expression level of each protein of the cytosolic Ca 2+ levels at rest, were normalized to the mean value of
approaches, identifying STIM2-binding region on CASQ1 if CASQ1 binds to STIM2, and examining the normalized to the mean value of the vector control those from the vector control. The values are presented as the mean ± SEM PCR primers (EcoR Ⅰ & Xho Ⅰ)
*
for the number of myotubes shown in parentheses. Significant difference
functional relevance of the CASQ1-STIM2 interaction in skeletal muscle using mouse primary skeletal is presented as histograms (mean ± SEM for three compared with vector control (p < 0.05). GST-C1 Forward 5’–GGAATTCATGGGGGCCAGAGCAGTG–3’
independent experiments, Supplementary Table S4).
5’ –CGCTCGAGCTACAGGATTAG–3’
Backward
myotubes (instead of a heterologous expression system involving variations in expression and artifacts), * Significant difference compared with vector Forward 5’–GGAATTCGAGTTAGCAG–3’
single-myotube Ca imaging experiments, and transmission electron microscopy (TEM) observations. control (p < 0.05). # Significant difference GST-C2 Backward 5’–CGCTCGAGCTAAATCAACTCTACAG–3’
2+
compared with WT CASQ1 (p < 0.05). (D) The Forward 5’–GGAATTCATGGGGGCCAGAGCAGTG–3’
myotube lysate was subjected to a GST-C3
coimmunoprecipitation assay with anti-Orai1 Vector control WT CASQ1 C1 Backward 5’–CGCTCGAGCTAATCCTTCTCTGAGTC–3’
antibody, and the immunoprecipitate was subjected Length of swelling mitochondria 1.00± 0.07 0.93 ± 0.09 0.38 ± 0.06 *, # GST-C4 Forward 5’–GGAATTCGCAGCTGTGGCCAAGAAA–3’
5’–CGCTCGAGCTACTCGCCGTCATATTC–3’
Backward
(37)
(53)
REFERENCES to immunoblot analysis with anti-Orai1 or anti- Expression level of Drp-1 1.00 ± 0.00 1.01 ± 0.05 1.39 ± 0.18 *, # Forward 5’–GGAATTCTTTTCTGCAGAC–3’
(35)
STIM2 antibody. ‘Myotube lysate’ in the left-hand
(3)
(3)
(3)
side indicates a simple immunoblot of the myotube 1.00 ± 0.00 1.00 ± 0.04 1.03 ± 0.05 GST-C5 Backward 5’–CGCTCGAGCTAAATCAACTCTACAG–3’
lysate. ‘Without anti-Orai1 Ab’ indicates a reaction Expression level of Mfn-1 (3) (3) (3) ▲ Supplementary Table S2. PCR primers for the cloning of
without anti-Orai1 antibody. Three independent GST-C regions (GST-C1 to GST-C5)
1. Cho, C.H.; Woo, J.S.; Perez, C.F.; Lee, E.H. A focus on extracellular Ca entry into skeletal muscle. Exp Mol Med 2017, 49, e378. experiments were conducted, and a representative
2+
2. Cho, C.H.; Lee, K.J.; Lee, E.H. With the greatest care, stromal interaction molecule (STIM) proteins verify what skeletal muscle is doing. BMB Rep 2018, 51, 378-387. ▲ Table 2. Length of mitochondria and expression level of Drp-1 or Mfn-
2+
3. Lee, E.H. Ca channels and skeletal muscle diseases. Prog Biophys Mol Biol 2010, 103, 35-43. result is presented. The degree of 1 in mouse primary skeletal myotubes that expressed the WT CASQ1 or
2+
4. Zucchi, R.; Ronca-Testoni, S. The sarcoplasmic reticulum Ca channel/ryanodine receptor: modulation by endogenous effectors, drugs and disease states. Pharmacol Rev 1997, 49, 1-51. coimmunoprecipitated STIM2 (i.e., the degree of C1 region. The values are presented as the mean ± SEM for the number of PCR primers (EcoR I & Sal I)
5. Lee, E.H.; Kim, D.H.; Allen, P.D. Interplay between intra- and extracellular calcium ions. Mol Cells 2006, 21, 315-329.
6. Boncompagni, S.; Rossi, A.E.; Micaroni, M.; Beznoussenko, G.V.; Polishchuk, R.S.; Dirksen, R.T.; Protasi, F. Mitochondria are linked to calcium stores in striated muscle by developmentally regulated coimmunoprecipitated STIM2 to total STIM2) mitochondria or experiments shown in parentheses. The values were Forward 5’-GGAATTCATGGGGGCCAGAGCAGTG-3’
*
tethering structures. Mol Biol Cell 2009, 20, 1058-1067. normalized to the mean value of the vector control normalized to the mean values of the vector control. Significant difference C1 region
7. Rossi, A.E.; Boncompagni, S.; Wei, L.; Protasi, F.; Dirksen, R.T. Differential impact of mitochondrial positioning on mitochondrial Ca 2+ uptake and Ca 2+ spark suppression in skeletal muscle. Am J is presented as histograms. IB, IP, or Ab indicates compared with vector control (p < 0.05). Significant difference compared Backward 5’-GCGTCGACTCACAGGATTAGCTCC-3’
#
Physiol Cell Physiol 2011, 301, C1128-1139.
++
++
8. Shamoo, A.E.; MacLennan, D.H. A Ca -dependent and -selective ionophore as part of the Ca ++ + Mg -dependent adenosinetriphosphatase of sarcoplasmic reticulum. Proc Natl Acad Sci U S A 1974, immunoblot, immunoprecipitation, or antibody, with WT CASQ1 (p < 0.05). ▲ Supplementary Table S3. PCR primers for the cloning of the C1
71, 3522-352. respectively. Significant difference was compared
*
9. Takeshima, H.; Komazaki, S.; Nishi, M.; Iino, M.; Kangawa, K. Junctophilins: a novel family of junctional membrane complex proteins. Mol Cell 2000, 6, 11-22. region into the pCMS-RFP vector
2+
10. Woo, J.S.; Cho, C.H.; Lee, K.J.; Kim, D.H.; Ma, J.; Lee, E.H. Hypertrophy in skeletal myotubes induced by junctophilin-2 mutant, Y141H, involves an increase in store-operated Ca entry via Orai1. J with vector control (p < 0.05).
Biol Chem 2012, 287, 14336-48.
11. Nishi, M.; Komazaki, S.; Kurebayashi, N.; Ogawa, Y.; Noda, T.; Iino, M.; Takeshima, H. Abnormal features in skeletal muscle from mice lacking mitsugumin29. J Cell Biol 1999, 147, 1473-1480.
2+
12. Feske, S. ORAI1 and STIM1 deficiency in human and mice: roles of store-operated Ca entry in the immune system and beyond. Immunol Rev 2009, 231, 189-209.
13. Prakriya, M.; Lewis, R.S. Store-Operated Calcium Channels. Physiol Rev 2015, 95, 1383-1436.
14. Pan, Z.; Brotto, M.; Ma, J. Store-operated Ca entry in muscle physiology and diseases. BMB Rep 2014, 47, 69-79.
2+
15. Zanou, N.; Shapovalov, G.; Louis, M.; Tajeddine, N.; Gallo, C.; Van Schoor, M.; Anguish, I.; Cao, M.L.; Schakman, O.; Dietrich, A., et al. Role of TRPC1 channel in skeletal muscle function. Am J
Physiol Cell Physiol 2010, 298, C149-162, doi:10.1152/ajpcell.00241.2009.
16. Lee, E.H.; Cherednichenko, G.; Pessah, I.N.; Allen, P.D. Functional coupling between TRPC3 and RyR1 regulates the expressions of key triadic proteins. J Biol Chem 2006, 281, 10042-8.
17. Choi, J.H.; Jeong, S.Y.; Oh, M.R.; Allen, P.D.; Lee, E.H. TRPCs: Influential Mediators in Skeletal Muscle. Cells 2020, 9.850. MATERI ALS & METHODS
18. Kiselyov, K.; Patterson, R.L. The integrative function of TRPC channels. Front Biosci (Landmark Ed) 2009, 14, 45-58.
19. Hoth, M.; Niemeyer, B.A. The neglected CRAC proteins: Orai2, Orai3, and STIM2. Curr Top Membr 2013, 71, 237-71.
20. Darbellay, B.; Arnaudeau, S.; Ceroni, D.; Bader, C.R.; Konig, S.; Bernheim, L. Human muscle economy myoblast differentiation and excitation-contraction coupling use the same molecular partners,
STIM1 and STIM2. J Biol Chem 2010, 285, 22437-47.
21. Phuong, T.T.T.; Kang, T.M. Stromal interaction molecule 2 regulates C2C12 myoblast differentiation. Integr Med Res 2015, 4, 242-248. Ethical approval
2+
2+
22. Oh, M.R.; Lee, K.J.; Huang, M.; Kim, J.O.; Kim, D.H.; Cho, C.H.; Lee, E.H. STIM2 regulates both intracellular Ca distribution and Ca movement in skeletal myotubes. Sci Rep 2017, 7, 17936.
23. Woo, J.S.; Jeong, S.Y.; Park, J.H.; Choi, J.H.; Lee, E.H. Calsequestrin: a well-known but curious protein in skeletal muscle. Exp Mol Med 2020, 52, 1908-1925. The methods were carried out in accordance with the regulations and guidelines of the College of Medicine at The Catholic University of Korea. The site where the animal work took place and all surgical interventions, including pre- and postsurgical animal care, were carried out in accordance with the Laboratory Animals Welfare Act, the Guide for Care and Use of Laboratory Animals, and the
24. MacLennan, D.H.; Wong, P.T. Isolation of a calcium-sequestering protein from sarcoplasmic reticulum. Proc Natl Acad Sci U S A 1971, 68, 1231-1235. Guidelines and Policies for Rodent Survival Surgery approved by the Institutional Animal Care and Use Committee of the College of Medicine at The Catholic University of Korea. All protocols for the experiments were approved by the Committee of the College of Medicine at The Catholic University of Korea.
25. Wei, L.; Varsanyi, M.; Dulhunty, A.F.; Beard, N.A. The conformation of calsequestrin determines its ability to regulate skeletal ryanodine receptors. Biophys J 2006, 91, 1288-1301.
26. Park, H.; Wu, S.; Dunker, A.K.; Kang, C. Polymerization of calsequestrin. Implications for Ca regulation. J Biol Chem 2003, 278, 16176-16182. cDNA construction and expression of the GST-CASQ1 or GST-CASQ1 regions
2+
2+
27. Shin, D.W.; Pan, Z.; Kim, E.K.; Lee, J.M.; Bhat, M.B.; Parness, J.; Kim, D.H.; Ma, J. A retrograde signal from calsequestrin for the regulation of store-operated Ca entry in skeletal muscle. J Biol cDNA of mouse CASQ1 was obtained from OriGene Technologies, Inc. (Rockville, MD, USA, #MR206274). To prepare cDNA for GST-tagged full-length CASQ1 (GST-CASQ1) or CASQ1 regions, oligonucleotide primers were designed on the basis of mouse CASQ1 (GenBank accession number: NM_009813) (Supplementary Tables S1 and S2). With the primers, PCR was performed (30
Chem 2003, 278, 3286-3292. cycles at 95 °C for 45 s, 63 °C for 45 s, and 68 °C for 90 s). The PCR products were subcloned into the pGEX-4T-1 vector. GST-CASQ1 or GST-CASQ1 regions were expressed in E. coli (DH5α) using 0.1 mM isopropyl-β-D-thiogalactopyranoside (Sigma–Aldrich, St. Louis, MO, U.S.A.), as previously described [22,36,37]. For expressing the full-length wild-type CASQ1 (WT CASQ1) in
28. Yarotskyy, V.; Protasi, F.; Dirksen, R.T. Accelerated activation of SOCE current in myotubes from two mouse models of anesthetic- and heat-induced sudden death. PLoS One 2013, 8, e77633. mouse primary skeletal myotubes, full-length CASQ1 in the pGEX-4T-1 vector was subcloned into the pCMS-RFP vector using EcoR I and Not I enzyme sites. For the C1 region, the PCR products using primers in Supplementary Table S3 were subcloned into the pCMS-RFP vector.
29. Lewis, K.M.; Ronish, L.A.; Rios, E.; Kang, C. Characterization of Two Human Skeletal Calsequestrin Mutants Implicated in Malignant Hyperthermia and Vacuolar Aggregate Myopathy. J Biol Chem
2015, 290, 28665-28674.
30. Barone, V.; Del Re, V.; Gamberucci, A.; Polverino, V.; Galli, L.; Rossi, D.; Costanzi, E.; Toniolo, L.; Berti, G.; Malandrini, A., et al. Identification and characterization of three novel mutations in the Triad sample preparation and the binding assay of CASQ1 regions with triad proteins
2+
CASQ1 gene in four patients with tubular aggregate myopathy. Hum Mutat 2017, 38, 1761-1773. Triad vesicles (that are enriched with triad proteins mediating intra- and extracellular Ca movements in skeletal muscle, including STIM2 [1-3,5]) were prepared and solubilized to create triad samples, as previously described [38-41]. Binding assays were performed as previously described [37]. Briefly, affinity beads were prepared by immobilizing the GST-CASQ1 or GST-CASQ1 regions on
31. Cendula, R.; Dragun, M.; Gazova, A.; Kyselovic, J.; Hulman, M.; Matus, M. Changes in STIM isoforms expression and gender-specific alterations in Orai expression in human heart failure. Physiol Res GST beads (Amersham, GE Healthcare Biosciences, Pittsburgh, PA). The affinity beads were then incubated with 150 μg of the triad sample for 6 h at 4 °C. The proteins that were bound to the affinity beads were separated on a 10% SDS–PAGE gel and subjected to an immunoblot assay.
2019, 68, S165-S172.
32. Spinelli, A.M.; Trebak, M. Orai channel-mediated Ca signals in vascular and airway smooth muscle. Am J Physiol Cell Physiol 2016, 310, C402-413. Cell culture and expression of the WT CASQ1 or C1 region
2+
33. Berna-Erro, A.; Jardin, I.; Salido, G.M.; Rosado, J.A. Role of STIM2 in cell function and physiopathology. J Physiol 2017, 595, 3111-3128, doi:10.1113/JP273889. Mouse primary skeletal myoblasts that were derived from mouse skeletal muscle using a single-cell cloning method were expanded and differentiated into myotubes, as previously described [41-45]. For differentiating the skeletal myoblasts to myotubes, myoblasts were replated on different plates coated with Matrigel (BD Biosciences, Sparks Glencoe, MD, U.S.A., 6-well plates for the TEM
34. Zhang, L.; Wang, L.; Li, S.; Xue, J.; Luo, D. Calsequestrin-1 Regulates Store-Operated Ca Entry by Inhibiting STIM1 Aggregation. Cell Physiol Biochem 2016, 38, 2183-2193. observation or immunocytochemistry experiment, 96-well plates for the single-myotube Ca imaging experiment, or 10-cm plates for other experiments). After three days of culture under differentiation conditions, premature myotubes were transfected with an empty vector as a control or cDNA encoding the WT CASQ1 or C1 region (a mixture of 30 µl of FuGENE6 (Promega, Madison, WI,
2+
2+
2+
35. Wang, L.; Zhang, L.; Li, S.; Zheng, Y.; Yan, X.; Chen, M.; Wang, H.; Putney, J.W.; Luo, D. Retrograde regulation of STIM1-Orai1 interaction and store-operated Ca entry by calsequestrin. Sci Rep U.S.A.) and 20 μg of cDNA per 10-cm dish, or the same ratio of components in the well of other plates, for 3 h). Mature myotubes were either observed, imaged, or disrupted at 36 h posttransfection for further experiments, at which time approximately 60% of the myotubes had been transfected, as estimated by the RFP signal. All reagents that were used for the cell cultures were obtained from
2015, 5, 11349. Invitrogen (Waltham, MA, U.S.A.).
36. Lee, E.H.; Rho, S.H.; Kwon, S.J.; Eom, S.H.; Allen, P.D.; Kim, D.H. N-terminal region of FKBP12 is essential for binding to the skeletal ryanodine receptor. J Biol Chem 2004, 279, 26481-26488.
2+
37. Lee, K.J.; Park, C.S.; Woo, J.S.; Kim, D.H.; Ma, J.; Lee, E.H. Mitsugumin 53 attenuates the activity of sarcoplasmic reticulum Ca -ATPase 1a (SERCA1a) in skeletal muscle. Biochem Biophys Res
Commun 2012, 428, 383-388. Coimmunoprecipitation and immunoblot assays
2+
38. Lee, K.J.; Hyun, C.; Woo, J.S.; Park, C.S.; Kim, D.H.; Lee, E.H. Stromal interaction molecule 1 (STIM1) regulates sarcoplasmic/endoplasmic reticulum Ca -ATPase 1a (SERCA1a) in skeletal muscle. Mouse primary skeletal myotubes were solubilized in lysis buffer, as previously described [10,22,38,41,42,44]. For the coimmunoprecipitation assay [22,41,42,44], solubilized myotube lysate (100 µg of total protein) and anti-CASQ1 (Affinity BioReagents, Golden, CO, U.S.A.) or anit-Orai1 antibody (Abcam, Cambridge, MA, U.S.A.) were used. The immunoprecipitate was subjected to
Pflugers Arch 2014, 466, 987-1001. immunoblot assays with anti-CASQ1, anti-Orai1, or anti-STIM2 antibody (Abcam). For the immunoblot assay, solubilized myotube lysate (10 μg of total protein) was subjected to SDS–PAGE (8, 10, or 12% gel) [10,22,38,41,42,44,46]. The anti-RyR1, anti-SERCA1a, anti-CASQ1, anti-CaM1, anti-JP1, and anti-JP2 antibodies were obtained from Affinity BioReagents. The anti-TRPC1, anti-
39. Saito, A.; Seiler, S.; Chu, A.; Fleischer, S. Preparation and morphology of sarcoplasmic reticulum terminal cisternae from rabbit skeletal muscle. J Cell Biol 1984, 99, 875-885. TRPC3, anti-TRPC4, and anti-TRPC6 antibodies were obtained from Alomone Laboratories (Jerusalem, Israel). The anti-TRIM32, anti-MyoD, and anti-myogenin antibodies were obtained from Santa Cruz Biotechnology (Dallas, TX, U.S.A.). The anti-DHPR, anti-STIM1, anti-STIM2, and anti-α-actin antibodies were obtained from Abcam.
40. Woo, J.S.; Kim, D.H.; Allen, P.D.; Lee, E.H. TRPC3-interacting triadic proteins in skeletal muscle. Biochem J 2008, 411, 399-405.
41. Choi, J.H.; Huang, M.; Hyun, C.; Oh, M.R.; Lee, K.J.; Cho, C.H.; Lee, E.H. A muscular hypotonia-associated STIM1 mutant at R429 induces abnormalities in intracellular Ca 2+ movement and Immunocytochemistry and width measurement
extracellular Ca entry in skeletal muscle. Sci Rep 2019, 9, 19140. For the immunocytochemistry experiments, myotubes were fixed in cold methanol (−20 °C) for 30 min, permeabilized with 0.05% Tween 20 phosphate-buffered saline for 1 min, and stained with anti-GFP (for detecting RFP-tagged proteins) and Cy3-conjugated secondary antibodies, as previously described [10,38,41,42,44]. Myotube widths (one criterion that is used to evaluate the degree of
2+
42. Lee, K.J.; Woo, J.S.; Hwang, J.H.; Hyun, C.; Cho, C.H.; Kim, D.H.; Lee, E.H. STIM1 negatively regulates Ca 2+ release from the sarcoplasmic reticulum in skeletal myotubes. Biochem J 2013, 453, skeletal myotube formation) were measured using the ImageJ program, as previously described [10,38,41,42,45,46].
187-200.
43. Rando, T.A.; Blau, H.M. Methods for myoblast transplantation. Methods Cell Biol 1997, 52, 261-272. 2+
2+
44. Ahn, M.K.; Lee, K.J.; Cai, C.; Huang, M.; Cho, C.H.; Ma, J.; Lee, E.H. Mitsugumin 53 regulates extracellular Ca entry and intracellular Ca 2+ release via Orai1 and RyR1 in skeletal muscle. Sci Rep Single-myotube Ca imaging
2+
2+
2016, 6, 36909. Single-myotube Ca imaging was performed using a high-speed monochromator with a 75 W xenon lamp (FSM150Xe, Bentham Instruments, Reading, Berkshire, U.K.) and an inverted-stage microscope (Nikon Eclipse TS100, Nikon Instruments, Inc., Melville, NY, U.S.A.). Mouse primary skeletal myotubes were loaded with 5 μM fura-2-AM (Invitrogen) for the measurement of cytosolic [Ca ]
2+
45. Woo, J.S.; Hwang, J.H.; Ko, J.K.; Weisleder, N.; Kim, D.H.; Ma, J.; Lee, E.H. S165F mutation of junctophilin 2 affects Ca signalling in skeletal muscle. Biochem J 2010, 427, 125-134. or fluo-4-AM (Invitrogen) for other measurements in imaging buffer (25 mM HEPES, pH 7.4, 125 mM NaCl, 5 mM KCl, 2 mM KH PO , 2 mM CaCl , 6 mM glucose, 1.2 mM MgSO , and 0.05% BSA) at 37 °C for 45 min, as previously described [10,22,38,41,42,44-46]. Either caffeine (20 mM) or KCl (60 mM) was dissolved in the imaging buffer and applied to myotubes via an autoperfusion
2
2
4
4
2+
2+
2+
46. Huang, M.; Lee, K.J.; Kim, K.J.; Ahn, M.K.; Cho, C.H.; Kim, D.H.; Lee, E.H. The maintenance ability and Ca availability of skeletal muscle are enhanced by sildenafil. Exp Mol Med 2016, 48, e278. system (AutoMate Scientific, St. Berkeley, CA, U.S.A.). The data were analyzed or displayed using image acquisition and analysis software (High-Speed InCyt Im2 for cytosolic [Ca ] and Im1 for other results, v5.29, Intracellular Imaging Inc., Cincinnati, OH, U.S.A.). To measure releasable Ca from the SR, thapsigargin (TG, 2.5 μM) dissolved in dimethyl sulfoxide (DMSO, < 0.05%, no effect
47. Madej, T.; Lanczycki, C.J.; Zhang, D.; Thiessen, P.A.; Geer, R.C.; Marchler-Bauer, A.; Bryant, S.H. MMDB and VAST+: tracking structural similarities between macromolecular complexes. Nucleic by itself) in the absence of extracellular Ca was applied to myotubes. For the SOCE measurement, Ca in the SR was depleted with TG (2.5 μM) in the absence of extracellular Ca , and once the cytosolic Ca level returned to baseline, Ca (2mM) was added to myotubes to measure SOCE. To analyze Ca movement, the peak amplitudes (which exhibited similar changes in peak areas) were
2+
2+
2+
2+
2+
2+
Acids Res 2014, 42, D297-303. measured. For long-term Ca movements such as SOCE or the response to TG, the area under the curve was analyzed. To analyze the initial rate of responses, the slope at the rising phase of the response was examined by a linear equation that was obtained from a linear fitting of the rising phase [10,22,41,44,45]. Reagents that were used for the single-myotube Ca imaging were obtained from
2+
2+
48. des Georges, A.; Clarke, O.B.; Zalk, R.; Yuan, Q.; Condon, K.J.; Grassucci, R.A.; Hendrickson, W.A.; Marks, A.R.; Frank, J. Structural Basis for Gating and Activation of RyR1. Cell 2016, 167, 145- Sigma–Aldrich.
157 e117.
49. Nicklas, S.; Otto, A.; Wu, X.; Miller, P.; Stelzer, S.; Wen, Y.; Kuang, S.; Wrogemann, K.; Patel, K.; Ding, H., et al. TRIM32 regulates skeletal muscle stem cell differentiation and is necessary for TEM observation
normal adult muscle regeneration. PLoS One 2012, 7, e30445.
2+
50. Murphy, R.M.; Larkins, N.T.; Mollica, J.P.; Beard, N.A.; Lamb, G.D. Calsequestrin content and SERCA determine normal and maximal Ca storage levels in sarcoplasmic reticulum of fast- and slow- For TEM observations, myotubes were fixed, embedded in epoxy resin (Epon 812), sectioned using an ultramicrotome (70–80 nm, Ultracut UCT ultramicrotome, Leica, Buffalo Grove, IL, U.S.A.), and examined under TEM (JEM1010, JEOL Ltd., Peabody, MA, U.S.A.) at 60 kV, as previously described [10,41]. To analyze the length of mitochondria, the mitochondrial length in a unit area
twitch fibres of rat. J Physiol 2009, 587, 443-460. (37.5 × 25.0 μm2) was measured using ImageJ software.
2+
51. Launikonis, B.S.; Murphy, R.M.; Edwards, J.N. Toward the roles of store-operated Ca entry in skeletal muscle. Pflugers Arch 2010, 460, 813-823.
52. Canato, M.; Scorzeto, M.; Giacomello, M.; Protasi, F.; Reggiani, C.; Stienen, G.J. Massive alterations of sarcoplasmic reticulum free calcium in skeletal muscle fibers lacking calsequestrin revealed by a Presentation of the three-dimensional (3D) structure of CASQ1For TEM observations, myotubes were fixed, embedded in epoxy resin (Epon 812), sectioned using an ultramicrotome (70–80 nm, Ultracut UCT ultramicrotome, Leica, Buffalo Grove, IL, U.S.A.), and examined under TEM (JEM1010, JEOL Ltd., Peabody, MA, U.S.A.) at 60 kV, as previously described [10,41]. To analyze the
genetically encoded probe. Proc Natl Acad Sci U S A 2010, 107, 22326-22331. length of mitochondria, the mitochondrial length in a unit area (37.5 × 25.0 μm ) was measured using ImageJ software.
2
53. Makarov, V.I.; Khmelinskii, I.; Khuchua, Z.; Javadov, S. In silico simulation of reversible and irreversible swelling of mitochondria: The role of membrane rigidity. Mitochondrion 2020, 50, 71-81. The 3D structure of human CASQ1 (PDB ID: 3UOM) is presented as a ribbon diagram using iCn3D (NCBI’s web-based 3D structure viewer) [47].
54. Lannergren, J.; Bruton, J.D. Mitochondrial Ca in mouse soleus single muscle fibres in response to repeated tetanic contractions. Adv Exp Med Biol 2003, 538, 557-562; discussion 562.
2+
55. Sembrowich, W.L.; Quintinskie, J.J.; Li, G. Calcium uptake in mitochondria from different skeletal muscle types. J Appl Physiol (1985) 1985, 59, 137-141. Statistical analysis
56. Smirnova, E.; Griparic, L.; Shurland, D.L.; van der Bliek, A.M. Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol Biol Cell 2001, 12, 2245-2256.
57. Budzinska, M.; Zimna, A.; Kurpisz, M. The role of mitochondria in Duchenne muscular dystrophy. J Physiol Pharmacol 2021, 72.157-166. The results are presented as the mean ± SEM for the number of myotubes or experiments shown in the figure legends or the table parentheses. Significant differences were analyzed using unpaired t-test (for Figures 1A and 2B) or one-way ANOVA (for others) (GraphPad InStat, v2.04, GraphPad Software, San Diego, CA, U.S.A.). The differences were considered to be significant for p < 0.05. The
58. Wang, S.; Trumble, W.R.; Liao, H.; Wesson, C.R.; Dunker, A.K.; Kang, C.H. Crystal structure of calsequestrin from rabbit skeletal muscle sarcoplasmic reticulum. Nat Struct Biol 1998, 5, 476-483. graphs were prepared using Origin 2019b (OriginLab, Northampton, MA, U.S.A.).

