Page 29 - ebook
P. 29
CRISPR-CasRx based Lamin A pre-mRNA knock-
down in Hutchinson-Gilford Progeria Syndrome
Juyoung Hong, Junho K Hur*
Graduate School of Biomedical Science & Enginerring, Hanyang University, Seoul 04763, Korea E-mail : juhur@hanyang.ac.kr
Figure 2. Scheme of Lamin A pre-mRNA targeting by CRISPR-CasRx.
Abstract
(A) Work flow to rescue HGPS cells. The use of an CRISPR-CasRx to
The Hutchinson-Gilford Progeria Syndrome (HGPS) is a rare and deadly knock-down the pathogenic lamin A mRNA in cultured fibroblasts derived from
genetic disease that exhibits premature aging and cellular senescence. children with progeria. (B) The LMNA c.1824 C>T mutation potentiates a cryp-
HGPS patients suffer from diverse senile diseases at an early age and pass tic splice site in exon 11 of the LMNA gene. Target gRNA1, LMNA intron
away for the most part from cardiovascular system complications around 11–exon 12 splice junction. Red line indicates alternative splicing leading to
the age of 14. One of the prevalent causes of HGPS is a genetic mutation progerin mRNA. SA: splice activator site; SD: splice donor site.
in lamin A (LMNA), which is an essential element in the nuclear lamina. The
Results
introduction of a de novo mutation in exon 11 of LMNA results in progerin
proteins, an abnormal form of lamin A, which accumulates progressively in Unaffected parent HGPS patient
the nuclear envelope. Currently, a study showed that CRISPR base editing derived fibroblast derived fibroblast
of mutant LMNA in the HGPS mouse model ameliorated the sign of illness
and extended the lifespan in mouse model. Nonetheless, CasRx based
gene therapy for HGPS in the human system has not been extensively in-
vestigated. Therefore, in this study, we sought to apply CRISPR-CasRx for
the knockdown of progerin mRNA in the HGPS patient-derived fibroblast to Progeria/LaminA/C/Hoechst
advance the development of gene therapy for HGPS.
Introduction
Lamin A/C both are the major elements of the mammalian nuclear lamina,
serving as scaffolding for membrane proteins and contributing to genome
stability. The HGPS is caused by a single point mutation in which C changes
to T in the LMNA gene that is encoding lamin A/C. When C1824T occurs in
the LMNA gene exon 11, the amino acid does not change because it is
G608G (GGC GGT) silent mutation. However, in the RNA splicing process, Progeria/LaminA/C/Hoechst
alternative splicing due to mutations occurs better, and not only intron but
also part of exon 11 is omitted. This deletion includes a cleavage site for
post-transcriptional processing. As a result, the cleavage that has to happen
in the post-translational process does not happen and progerin, an abnormal
form of Lamin A, is produced. When progerins are piled up, they do not func- Figure 3. Comparison of normal cells and HGPS patient derived cells by ICC
tion properly as structural support for the nuclear envelope and cause nucle- Nuclear morphology of unaffected parent derived cells, HGPS patient de-
ar membrane deformation. This affects even changes in the gene expression rived cells stained with a lamin-A-specific antibody, a progerin-specific anti-
profile, such as the loss of heterochromatin and genome instability. The body or Hoechst. It was confirmed that the accumulation of progerin in the
above phenomena, which are caused by the accumulation of progerins, are nuclear membrane increased the number of fibroblasts with unevenly
found not only in HGPS but also in normal physical aging processes.
1.5 1.5
Figure 4. Quantitative PCR (qPCR)
A. B. 1.0 1.0 of LMNA and progerin transcripts.
LMNA relative expression 0.5 LMNA C1824T relative expression 0.5 Cells 3 days after treatment with
CRISPR-CasRx. Normalized to
TBP. WT: LMNA wild-type mini
gene, MUT: LMNA C1824U mutant
0.0 0.0
mock gRNA1 mock gRNA1 minigene construct.
Conclusions
1. Progerin accumulation in HGPS fibroblasts correlates with nuclear de-
fects. Accumulation of progerin leads to various ageing-associated nuclear
defects including disorganization of nuclear lamina and loss of heterochro-
matin. It was confirmed that this worsened with incresed cell passage
Figure 1. Pathological mechanism of HGPS
number in patient-derived cells.
(A) A HGPS patient, Sam Berns (October 23, 1996 – January 10, 2014). (B)
2. It was confirmed that CasRx-gRNA1, targeting LMNA intron 11–exon 12
LMNA C1824T leads to the activation of a cryptic splice donor site.
splice junction, knock down the lamina pre-mRNA. However, not only the
progerin mRNA that produces progeria was knock down, but also the normal
Concepts
lamin A mRNA was knock down. It will be a better study if a CRISPR-CasRx
A. system that specifically knocks down progerin mRNA is developed.
References
[1] Santiago-Fernández, O., Osorio, F. G., Quesada, V., Rodríguez, F., Basso, S.,
Maeso, D., ... & Freije, J. M. (2019). Development of a CRISPR/Cas9-based therapy
for Hutchinson–Gilford progeria syndrome. Nature medicine, 25(3), 423.
[2] Beyret, E., Liao, H. K., Yamamoto, M., Hernandez-Benitez, R., Fu, Y., Erikson, G.,
... & Belmonte, J. C. I. (2019). Single-dose CRISPR–Cas9 therapy extends lifespan
of mice with Hutchinson–Gilford progeria syndrome. Nature medicine, 25(3), 419.
[3] Cho, S., Abbas, A., Irianto, J., Ivanovska, I. L., Xia, Y., Tewari, M., & Discher, D. E.
(2018). Progerin phosphorylation in interphase is lower and less mechanosensitive
B. than lamin-A, C in iPS-derived mesenchymal stem cells. Nucleus, 9(1), 235-250.
Pre-progerin mRNA [4] Anzalone, A. V., Randolph, P. B., Davis, J. R., Sousa, A. A., Koblan, L. W., Levy,
formation
Lamin A pre-mRNA J. M., ... & Liu, D. R. (2019). Search-and-replace genome editing without dou-
* ble-strand breaks or donor DNA. Nature.
SD SA SD SD SA
[5] Koblan, L. W., Erdos, M. R., Wilson, C., Cabral, W. A., Levy, J. M., Xiong, Z. M.,
1 9 10 11 12
... & Liu, D. R. (2021). In vivo base editing rescues Hutchinson–Gilford progeria syn-
drome in mice. Nature, 589(7843), 608-614.
11 intron + 12 exon gRNA1 [6] Puttaraju, M., Jackson, M., Klein, S., Shilo, A., Bennett, C. F., Gordon, L., ... &
Misteli, T. (2021). Systematic screening identifies therapeutic antisense oligonucle-
5’ CUUAGAGCCCCCAGAACUGCAG 3’ otides for Hutchinson–Gilford progeria syndrome. Nature Medicine, 27(3), 526-535.
3’ GAAUCUCGGGGGUCUUGACGUC 5’ [7] https://www.hbo.com/documentaries/life-according-to-sam

