Page 3 - K. Development and regeneration
P. 3

A                                                                     B                                                                          C          4                       Fer1L4

                                                                                                                                                                                                                                                                                                                                                 Fer1L4 is not targeted by LP

                                                                                                                                                                                                                                                                                                                                                      200 bp                                                           3
                                                                                                                                                                                                                                                                                                                                                                                                                     Relative Copy No.  2  ▼  ▼                     ▼
                                                                                                                                                                                                                                                                                                                                          Fer1L4 Fwd         Fer1L4 Rev

                                                                                                                                                                                                                                                                                                                                         Fer1L4          1 1                2      3             9




                                                                                                                                                                                                                                                                         DIC            mCherry                Merged                              Fer1L4 is targeted by LP                                            1      ▼      ▼           ▼       ▼  ▼

                                                                                                                                                                                                                                                                                                                                                  3,300 bp


                                                                                                                                                                                                                                                                                                                                          Fer1L4 Fwd   CMV Fer1L4 Rev                                                  0
                                                                                                                                                                                                                                                                                                                                      1       mCherry      TK        1      2      3              9

                                                                                                                                                                                                                                                                                                                                         Lox5171              LoxP

                                                                                                                                                                                                                                                                                                                                       Primer    Sequence (5' to 3')   Primer      Sequence (5' to 3')                      Negative control  mCherry positive #01  mCherry positive #02  mCherry positive #03  mCherry positive #04  mCherry positive #05  mCherry positive #06  mCherry positive #07  mCherry positive #08  mCherry positive #09  mCherry positive #10  mCherry positive #11  mCherry positive #12
                                                                                                                                                                                                                                                                                                                                      Fer1L4  GCACTGCGCCATGGCTCT       Fer1L4   GACGGGTTATAGAGCTGG
                                                                                                                                                                                                                                                                                                                                        Fwd                             Rev
                                                                                                                                                                                                                                                                                                                                      GAPDH GCACCACCAACTGCTTAG         GAPDH  AGTCTTCTGGGTGGCAGT
                                                                                                                                                                                                                                                                                                                                        Fwd   C                         Rev     GA


                                                                                                                                                                                                                                                                                       D                                                                                 E

                                                                                                                                                                                                                                                                                                                                                                                                                                rd
                                                                                                                                                                                                                                                                                            1 590 bp                                                                                 1 st  590 bp        2 nd  436 bp         3 348 bp
                                                                                                                                                                                                                                                                                              st
                                                                                                                                                                                                                                                                                             2 nd 436 bp
                                                                                                                                                                                                                                                                                                                                                                                                                                           C
                                                                                                                                                                                                                                                                                             3 348 bp                                                                                negative control  #4  #6 #8 #9 #11  negative control  #4  #6  #8 #9 #11  negative control  #4  #6  #8 #9 #11
                                                                                                                                                                                                                                                                                              rd
                                                                                                                                                                                                                                                                                                            CMV
                                                                                                                                                                                                                                                                                            1      mCherry      TK         1     2       3             9                     600

                                                                                                                                                                                                                                                                                               Lox5171             LoxP                                                      500
                                                                                                                                                                                                                                                                                         Primer    Sequence (5' to 3')   Primer      Sequence (5' to 3')                     300
                                                                                                                                                                                                                                                                                          st
                                                                                                                                                                                                                                                                                                                          st
                                                                                                                                                                                                                                                                                         1 Fwd TCACGGGCTAGCAAGGAC        1 Rev GAGCCGTACATGAACTGA
                                                                                                                                                                                                                                                                                         2 nd Fwd TACCCGATCCCAGCTC       2 nd  Rev CCCTCGATCTCGAACT
                                                                                                                                                                                                                                                                                                                          rd
                                                                                                                                                                                                                                                                                          rd
                                                                                                                                                                                                                                                                                         3 Fwd CGACGGTATGGGAAGA          3 Rev CGTGGCCGTTCACGGAGC
                                                                                                                                                                                                                                                                                                                                                                         F
                                                                                                                                                                                                                                                                                                                                                                                Genome     5’ Homologous arm    5’ Homologous arm     Lox5171



















                A                                                                     C    Fer1L4        1          2       3                    9            D




                                                                                                                                                               Fer1L4
                       Fer1L4        1         2       3                     9                             Cleavage                                                                CMV
                                                                                                                                                                  1       mCherry      TK        1      2       3             9
                                                                                                     AGACGCCTAACAGAGCTGCCAGGCA
                                                                                                     TCTGCGGATTGTCTCGACGGTCCGT                                       Lox5171              LoxP
                                                                                                   5’AGACGCCTAACAGAGCTGCCAGG
                                                                                                             Cas9                      gRNA   3’                  CRE                           CRE
                                                       CMV
                                              mCherry      TK                                                                                                                      SV40
                                        Lox5171               LoxP
                                5′ HA                               3′ HA                                                                                                  eGFP        Neo
                                                                                                                                                                    Lox5171               LoxP
                                           Landing pad (LP)                                            homologous recombination

                                                                                                                     CMV                                                  Targeting vector
                                                                                                             mCherry     TK
                                                                                                       Lox5171               LoxP
                B                                                                       5’ homologous arm                          3’ homologous arm

                                                     SV40
                                                                                                         RMCE Landing pad                                      Fer1L4              SV40
                                             eGFP        Neo
                                                                                                                                                                  1        eGFP        Neo       1      2       3             9
                                      Lox5171               LoxP
                                                                                                                                                                     Lox5171              LoxP
                                        Targeting vector (TV)                                              CMV
                                                                                           1       mCherry     TK         1     2        3            9

                                                                                              Lox5171              LoxP

















































                                                                                                                                                                                                                                                             A                                                                B      332 bp                                                              C




                                                                                                                                                                                                                                                                                                                                                   SV40                                                            5
                                                                                                                                                                                                                                                                                                                                  1        eGFP        Neo       1     2        3            9                     4
                                                                                                                                                                                                                                                                                                                                     Lox5171              LoxP                                                               **
                                                                                                                                                                                                                                                                                                                                  Primer     Sequence (5' to 3')  Primer     Sequence (5' to 3')                   3
                                                                                                                                                                                                                                                                                                                                   Fwd AGACTGAGCCACAGCACTGC         Rev CGCAGCCCTCCATGGTGAAC                   Percentage of cells expressing GFP, but not mCherry (%)  2


                                                                                                                                                                                                                                                                                                                                                       Before RMCE  After RMCE                                     0
                                                                                                                                                                                                                                                                                       DIC              mCherry                                                                                                    1


                                                                                                                                                                                                                                                                                                                                                                                                                         Before RMCE  After RMCE









                                                                                                                                                                                                                                                                                     GFP                 Marged                              500                                                          D                                E         82
                                                                                                                                                                                                                                                                                                                                             300
                                                                                                                                                                                                                                                                                                                                                                                                               Percentage of cells expressing GFP, but not mCherry (%)  3  Percentage of cells expressing GFP, but not mCherry (%)  79

                                                                                                                                                                                     Save cost & time!                                                                                                                          5’ Homologous arm       Lox5171                  GFP                               5 4 **                            81                  **
                                                                                                                                                                                                                                                                                                                                                                                                                                                     80


                                                                                                                                                                                                                                                                                                                                                                                                                                                      6
                                                                                                                                                                                                                     Decrease                                                                                                                                                                                      2                                  4           **
                                                                                                Minimum 12 months                                                                                                    processing time                                                                                                                                                                               1                                  2




                                                                                                                                                                              Save cost & time!                                                                                                                                                                                                                    0    g CRE  g CRE  g CRE  g CRE    0

                                                                                                                                                                                                                                                                                                                                                                                                                                                        Before RMCE  Before sorting  After sorting
                                                                                                                                                                                                                                                                                                                                                                                                                        0.5   1.0   2.0   4.0

                                                                                                                                                                                                                                                                                                                                                                                                                       2 .0  g Ta rg e tin g  ve c to r
                                                                                                                                                                                                                                                                                                                                                                                                                                                                     After
                                                                                                                                                                                                                                                                                                                                                                                                                                                                    RMCE
   1   2   3   4   5   6   7   8